Incidental Mutation 'R0928:Dach1'
ID80690
Institutional Source Beutler Lab
Gene Symbol Dach1
Ensembl Gene ENSMUSG00000055639
Gene Namedachshund family transcription factor 1
SynonymsDac, E130112M23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0928 (G1)
Quality Score185
Status Not validated
Chromosome14
Chromosomal Location97786853-98169765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97915832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 467 (S467G)
Ref Sequence ENSEMBL: ENSMUSP00000071464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069334
AA Change: S415G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639
AA Change: S415G

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 159 275 4.8e-53 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 443 470 N/A INTRINSIC
SCOP:d1eq1a_ 556 674 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071533
AA Change: S467G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639
AA Change: S467G

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 164 274 6.5e-42 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 495 522 N/A INTRINSIC
SCOP:d1eq1a_ 608 726 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156684
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Dach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Dach1 APN 14 97901422 missense possibly damaging 0.83
IGL01101:Dach1 APN 14 97840204 missense possibly damaging 0.83
IGL02033:Dach1 APN 14 97901429 missense possibly damaging 0.82
IGL02116:Dach1 APN 14 97901423 missense probably damaging 0.98
IGL02583:Dach1 APN 14 97828394 splice site probably benign
IGL02937:Dach1 APN 14 97915795 critical splice donor site probably null
IGL03120:Dach1 APN 14 97827789 missense probably damaging 1.00
R0016:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0017:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0117:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0334:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0336:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0371:Dach1 UTSW 14 97969903 missense probably damaging 0.99
R0511:Dach1 UTSW 14 97901329 missense possibly damaging 0.94
R0538:Dach1 UTSW 14 97903279 missense possibly damaging 0.80
R0799:Dach1 UTSW 14 98168615 missense possibly damaging 0.79
R0939:Dach1 UTSW 14 97915924 missense probably damaging 0.99
R1512:Dach1 UTSW 14 97901399 missense probably damaging 0.99
R1646:Dach1 UTSW 14 98169114 missense unknown
R1865:Dach1 UTSW 14 97840209 missense possibly damaging 0.68
R1881:Dach1 UTSW 14 97901396 missense probably benign 0.20
R1909:Dach1 UTSW 14 97901393 missense probably damaging 1.00
R1980:Dach1 UTSW 14 97831341 missense probably damaging 1.00
R2215:Dach1 UTSW 14 98168481 critical splice donor site probably null
R2570:Dach1 UTSW 14 97901411 missense probably benign 0.17
R3924:Dach1 UTSW 14 97915903 missense probably damaging 1.00
R3957:Dach1 UTSW 14 97840109 missense probably damaging 0.99
R4095:Dach1 UTSW 14 97901379 missense possibly damaging 0.92
R4373:Dach1 UTSW 14 97827750 missense possibly damaging 0.94
R5350:Dach1 UTSW 14 97969959 missense probably damaging 1.00
R5428:Dach1 UTSW 14 98169269 missense unknown
R5818:Dach1 UTSW 14 98168684 missense probably damaging 1.00
R6824:Dach1 UTSW 14 98018892 missense possibly damaging 0.81
R6967:Dach1 UTSW 14 97903197 missense probably damaging 1.00
R7263:Dach1 UTSW 14 98168859 missense probably benign
R7701:Dach1 UTSW 14 97903234 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATTCAGGTGCTCAGACGAATTG -3'
(R):5'- AGCCTCAACACAGCAGTGATGG -3'

Sequencing Primer
(F):5'- TGCTCAGACGAATTGAAGTATATAAC -3'
(R):5'- TCACCATGGCAATGAGTCAG -3'
Posted On2013-11-07