Incidental Mutation 'R0882:Tmem109'
ID80691
Institutional Source Beutler Lab
Gene Symbol Tmem109
Ensembl Gene ENSMUSG00000034659
Gene Nametransmembrane protein 109
Synonymsmitsugumin23, 1110006I15Rik, MG23
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10870660-10882001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10871841 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 217 (R217G)
Ref Sequence ENSEMBL: ENSMUSP00000039529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025645] [ENSMUST00000038128] [ENSMUST00000120524] [ENSMUST00000128835] [ENSMUST00000133303] [ENSMUST00000144681] [ENSMUST00000147699]
Predicted Effect probably benign
Transcript: ENSMUST00000025645
SMART Domains Protein: ENSMUSP00000025645
Gene: ENSMUSG00000024736

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:TMEM132D_N 44 167 1.6e-35 PFAM
low complexity region 206 223 N/A INTRINSIC
Pfam:TMEM132 403 745 4.1e-108 PFAM
low complexity region 759 776 N/A INTRINSIC
Pfam:TMEM132D_C 809 897 1.5e-31 PFAM
low complexity region 906 923 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 960 976 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038128
AA Change: R217G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039529
Gene: ENSMUSG00000034659
AA Change: R217G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:BRI3BP 57 231 9.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120524
SMART Domains Protein: ENSMUSP00000113696
Gene: ENSMUSG00000024736

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128835
SMART Domains Protein: ENSMUSP00000122130
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129052
Predicted Effect probably benign
Transcript: ENSMUST00000133303
SMART Domains Protein: ENSMUSP00000120261
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:BRI3BP 54 213 8.1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138897
Predicted Effect probably benign
Transcript: ENSMUST00000144681
SMART Domains Protein: ENSMUSP00000116750
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147699
SMART Domains Protein: ENSMUSP00000120662
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:BRI3BP 54 115 1.7e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, overtly normal and exhibit normal thymocyte maturation; however, mutant thymocytes are less sensitive to DNA damage caused by gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Tmem109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03003:Tmem109 APN 19 10874331 missense probably benign 0.27
R1221:Tmem109 UTSW 19 10874369 missense possibly damaging 0.88
R1571:Tmem109 UTSW 19 10872629 missense probably damaging 1.00
R5437:Tmem109 UTSW 19 10872014 missense probably damaging 1.00
R6367:Tmem109 UTSW 19 10874363 missense possibly damaging 0.66
R6708:Tmem109 UTSW 19 10872031 missense probably damaging 1.00
R7422:Tmem109 UTSW 19 10871760 makesense probably null
R7867:Tmem109 UTSW 19 10878102 missense unknown
Predicted Primers PCR Primer
(F):5'- TAATCATCACGGAGATCAGCGGGC -3'
(R):5'- CACTGGTCATCTACTGGTTGCTGTC -3'

Sequencing Primer
(F):5'- AGGGAGCCATCACTTGACTG -3'
(R):5'- ACTGGTTGCTGTCCCTGC -3'
Posted On2013-11-07