Incidental Mutation 'R0928:Gtf2h4'
ID80695
Institutional Source Beutler Lab
Gene Symbol Gtf2h4
Ensembl Gene ENSMUSG00000001524
Gene Namegeneral transcription factor II H, polypeptide 4
Synonymsp52
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0928 (G1)
Quality Score223
Status Not validated
Chromosome17
Chromosomal Location35667730-35673739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35670885 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 152 (Y152C)
Ref Sequence ENSEMBL: ENSMUSP00000124683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000159852] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144]
Predicted Effect probably damaging
Transcript: ENSMUST00000001565
AA Change: Y152C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000043674
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159671
Predicted Effect probably benign
Transcript: ENSMUST00000159852
SMART Domains Protein: ENSMUSP00000124060
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 61 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160039
AA Change: Y152C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160711
Predicted Effect probably damaging
Transcript: ENSMUST00000160734
AA Change: Y152C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
AA Change: M151V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524
AA Change: M151V

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the general transcription factor multiprotein complex that plays roles in basal transcription, DNA repair and cell cycle control. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Gtf2h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Gtf2h4 APN 17 35669982 missense probably damaging 1.00
IGL03412:Gtf2h4 APN 17 35668483 missense probably damaging 0.98
miramont UTSW 17 32345378 missense probably damaging 0.97
R0112:Gtf2h4 UTSW 17 35670448 missense possibly damaging 0.93
R0554:Gtf2h4 UTSW 17 35668639 missense probably benign 0.06
R1917:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R1918:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R2264:Gtf2h4 UTSW 17 35668664 unclassified probably benign
R2287:Gtf2h4 UTSW 17 35671225 critical splice donor site probably null
R2357:Gtf2h4 UTSW 17 35667999 missense probably damaging 1.00
R2519:Gtf2h4 UTSW 17 35670909 missense probably damaging 1.00
R4021:Gtf2h4 UTSW 17 35670664 missense probably benign 0.35
R4881:Gtf2h4 UTSW 17 35670233 missense possibly damaging 0.94
R5747:Gtf2h4 UTSW 17 35670381 missense possibly damaging 0.66
R5889:Gtf2h4 UTSW 17 35670900 missense possibly damaging 0.51
R6356:Gtf2h4 UTSW 17 35669755 missense probably damaging 0.99
R7323:Gtf2h4 UTSW 17 35669965 missense probably damaging 0.99
R7426:Gtf2h4 UTSW 17 35669358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAAGTGCAAGACCACCTAGAG -3'
(R):5'- AGGCAAGGGGAACTGCTTATTACAC -3'

Sequencing Primer
(F):5'- CCACCTAGAGACGAAAAGGGTC -3'
(R):5'- CCTTGGAATGCTCCTTCAAGAATAC -3'
Posted On2013-11-07