Mutagenetix > Incidental Mutations

Incidental Mutation 'R0928:Mut'

80697

Institutional Source

Beutler Lab

Gene Symbol

Mut

Ensembl Gene

ENSMUSG00000023921

Gene Name

methylmalonyl-Coenzyme A mutase

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0928 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

40934685-40961989 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40937283 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 67 (I67T)

Ref Sequence

ENSEMBL: ENSMUSP00000130941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087114] [ENSMUST00000169611]

Predicted Effect

probably benign
Transcript: ENSMUST00000087114

SMART Domains

Protein: ENSMUSP00000084353
Gene: ENSMUSG00000023919

Domain	Start	End	E-Value	Type
Pfam:CENP-Q	118	268	7.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169611
AA Change: I67T

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: I67T

Domain	Start	End	E-Value	Type
Pfam:MM_CoA_mutase	60	572	3.7e-240	PFAM
Pfam:B12-binding	613	731	4.7e-17	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.1%
10x: 93.0%
20x: 75.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,582	D745G	possibly damaging	Het
4931406P16Rik	A	T	7: 34,248,246		probably null	Het
Abca12	T	A	1: 71,349,174	D179V	probably benign	Het
Abcc1	T	C	16: 14,389,985		probably null	Het
Adad1	G	A	3: 37,076,740		probably null	Het
Apobec4	T	C	1: 152,756,277	Y19H	probably damaging	Het
Bco2	T	A	9: 50,545,931	T104S	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
Ccdc144b	A	C	3: 36,025,366	N258K	possibly damaging	Het
Ccs	T	C	19: 4,825,960	E184G	probably damaging	Het
Cfap70	T	G	14: 20,443,919	K97N	probably damaging	Het
Daam2	T	C	17: 49,488,227	I313V	probably benign	Het
Dach1	T	C	14: 97,915,832	S467G	probably damaging	Het
Dnah11	A	G	12: 118,045,562	S2122P	probably damaging	Het
Dnah3	T	A	7: 120,030,051	D1427V	probably damaging	Het
Dnaic1	T	C	4: 41,602,566	F97L	possibly damaging	Het
Dsc1	A	T	18: 20,110,249		probably null	Het
En2	A	T	5: 28,170,331	K291*	probably null	Het
Eps15	T	C	4: 109,312,963	V154A	possibly damaging	Het
Etnk1	A	G	6: 143,184,703	I183V	probably benign	Het
Fcrlb	A	T	1: 170,907,940	V255D	possibly damaging	Het
Fry	A	T	5: 150,437,084	E52V	probably damaging	Het
Gm8251	C	A	1: 44,057,228	S1570I	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,885	Y152C	probably damaging	Het
Hao1	C	A	2: 134,505,616	L256F	possibly damaging	Het
Helz	T	A	11: 107,626,693	I685K	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Izumo2	A	T	7: 44,715,423	I171F	possibly damaging	Het
Krt83	C	A	15: 101,491,280	C57F	probably benign	Het
Mapkbp1	A	G	2: 120,015,368	H400R	probably benign	Het
Megf6	T	A	4: 154,177,047	V43E	probably damaging	Het
Ninl	A	T	2: 150,963,475	V396E	probably damaging	Het
Nvl	A	T	1: 181,093,902	V844E	probably benign	Het
Olfr11	C	T	13: 21,638,956	C189Y	probably damaging	Het
P2rx3	A	T	2: 85,035,298	M1K	probably null	Het
Pabpn1l	T	C	8: 122,622,619	T20A	probably benign	Het
Ppp3r2	C	A	4: 49,681,439		probably null	Het
Prmt6	C	T	3: 110,250,682	G97D	probably damaging	Het
Prmt9	T	C	8: 77,581,176	V823A	probably damaging	Het
Skint11	C	A	4: 114,244,601	D79E	possibly damaging	Het
Slc17a8	T	A	10: 89,598,683	H194L	probably damaging	Het
Slco6c1	T	A	1: 97,104,848	I293F	possibly damaging	Het
Tcl1b4	A	T	12: 105,202,606	H43L	probably benign	Het
Tm9sf1	T	C	14: 55,636,457	D528G	probably damaging	Het
Tpbpb	C	T	13: 60,902,175	V47I	probably benign	Het
Ttc37	T	G	13: 76,113,592	L142W	probably damaging	Het
Ttn	G	T	2: 76,907,532		probably benign	Het
Usp28	T	G	9: 49,030,891	S341A	possibly damaging	Het
Vwa5a	T	C	9: 38,728,007	Y345H	probably damaging	Het
Wdr11	C	A	7: 129,606,653	D377E	probably damaging	Het
Zer1	A	G	2: 30,101,763		probably null	Het

Other mutations in Mut

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01482:Mut	APN	17	40956271	missense	probably damaging	0.99
IGL01666:Mut	APN	17	40958811	missense	probably damaging	1.00
IGL02141:Mut	APN	17	40938817	missense	possibly damaging	0.68
IGL02257:Mut	APN	17	40938734	missense	possibly damaging	0.78
IGL02538:Mut	APN	17	40938619	missense	probably damaging	1.00
mix	UTSW	17	40941383	missense	possibly damaging	0.66
mongrel	UTSW	17	40938731	missense	possibly damaging	0.77
R0115:Mut	UTSW	17	40956227	missense	probably damaging	1.00
R0381:Mut	UTSW	17	40937258	missense	probably benign	0.04
R0603:Mut	UTSW	17	40947166	missense	probably damaging	0.99
R1292:Mut	UTSW	17	40941407	missense	probably damaging	1.00
R1452:Mut	UTSW	17	40937468	splice site	probably benign
R1460:Mut	UTSW	17	40937375	missense	probably damaging	1.00
R2044:Mut	UTSW	17	40941451	missense	probably benign	0.00
R2256:Mut	UTSW	17	40956319	missense	probably benign	0.02
R2448:Mut	UTSW	17	40958841	missense	probably damaging	0.96
R3113:Mut	UTSW	17	40958356	missense	probably damaging	1.00
R3176:Mut	UTSW	17	40958872	splice site	probably null
R3276:Mut	UTSW	17	40958872	splice site	probably null
R3894:Mut	UTSW	17	40955139	missense	probably damaging	0.97
R4624:Mut	UTSW	17	40947055	missense	probably damaging	1.00
R4801:Mut	UTSW	17	40937351	missense	probably benign	0.08
R4802:Mut	UTSW	17	40937351	missense	probably benign	0.08
R5031:Mut	UTSW	17	40938827	missense	possibly damaging	0.96
R5394:Mut	UTSW	17	40947184	missense	probably benign	0.02
R5651:Mut	UTSW	17	40947111	missense	probably damaging	1.00
R6225:Mut	UTSW	17	40938731	missense	possibly damaging	0.77
R6274:Mut	UTSW	17	40956245	missense	probably benign	0.00
R7002:Mut	UTSW	17	40941383	missense	possibly damaging	0.66
R7141:Mut	UTSW	17	40952839	missense	possibly damaging	0.68
R7203:Mut	UTSW	17	40938673	missense	probably benign	0.06
R7868:Mut	UTSW	17	40947043	missense	probably damaging	1.00
R8050:Mut	UTSW	17	40943893	missense	probably benign	0.06
R8228:Mut	UTSW	17	40937328	missense	possibly damaging	0.92
RF021:Mut	UTSW	17	40951758	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCAGCTAAACATTCCATCAGCTTCCAG -3'
(R):5'- AGCATCCACTTGTTTCACAGCAAATTC -3'

Sequencing Primer
(F):5'- TCAGCTTCCAGATGGAAACG -3'
(R):5'- CTCATGTCATCATAAGCATCATGTC -3'

Posted On

2013-11-07