Incidental Mutation 'R0930:Sptan1'
ID 80715
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0930 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 29855572-29921463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29906040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1662 (N1662S)
Ref Sequence ENSEMBL: ENSMUSP00000092697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably benign
Transcript: ENSMUST00000046257
AA Change: N1642S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: N1642S

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: N1662S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: N1662S

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
AA Change: N1667S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: N1667S

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
AA Change: N1647S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: N1647S

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
AA Change: N1647S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: N1647S

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: N1667S
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: N1667S

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Meta Mutation Damage Score 0.1106 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G T 17: 84,990,705 (GRCm39) V16L probably benign Het
Adamts18 A T 8: 114,432,028 (GRCm39) probably null Het
Agpat4 A T 17: 12,417,723 (GRCm39) E88V probably damaging Het
Ahcyl2 A C 6: 29,870,627 (GRCm39) probably null Het
Ankrd2 T A 19: 42,032,292 (GRCm39) probably null Het
Anxa6 A T 11: 54,885,214 (GRCm39) probably null Het
Bpi A G 2: 158,103,346 (GRCm39) I114V possibly damaging Het
Cacna1c A T 6: 118,652,857 (GRCm39) I772N probably damaging Het
Cacna2d1 A G 5: 16,570,860 (GRCm39) N1045D possibly damaging Het
Caprin2 T C 6: 148,785,009 (GRCm39) probably null Het
Cars1 T A 7: 143,124,307 (GRCm39) H373L probably damaging Het
Ccdc191 G T 16: 43,751,618 (GRCm39) G316V probably damaging Het
Cd244a T A 1: 171,404,801 (GRCm39) probably null Het
Ces1a C T 8: 93,749,044 (GRCm39) D456N probably benign Het
Cul3 A T 1: 80,267,835 (GRCm39) M102K probably damaging Het
Dact1 A G 12: 71,365,234 (GRCm39) R672G probably damaging Het
Dapk1 T C 13: 60,905,262 (GRCm39) F991L probably benign Het
Dlg5 G A 14: 24,185,645 (GRCm39) P1920L probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Exosc4 A G 15: 76,211,734 (GRCm39) I14M probably benign Het
Ezr G A 17: 7,021,398 (GRCm39) R180* probably null Het
Fcgbpl1 A T 7: 27,839,555 (GRCm39) Y456F probably damaging Het
Fyb1 A T 15: 6,668,309 (GRCm39) I501F probably damaging Het
Hdac5 G T 11: 102,095,472 (GRCm39) P383Q probably benign Het
Hmx3 A T 7: 131,144,813 (GRCm39) H41L probably benign Het
Krt36 A G 11: 99,994,225 (GRCm39) F284S probably damaging Het
L1td1 A G 4: 98,625,862 (GRCm39) N686D probably damaging Het
Lsamp G A 16: 41,709,327 (GRCm39) G86S probably benign Het
Myh8 A G 11: 67,196,824 (GRCm39) E1819G possibly damaging Het
Myo7a A T 7: 97,747,463 (GRCm39) I129N probably damaging Het
Nckap1 A T 2: 80,384,593 (GRCm39) C114S probably benign Het
Nphp4 T G 4: 152,622,512 (GRCm39) L599R probably benign Het
Nrcam A G 12: 44,596,667 (GRCm39) I301V probably benign Het
Or6b2b A G 1: 92,419,127 (GRCm39) S117P possibly damaging Het
Os9 C T 10: 126,932,924 (GRCm39) R547Q probably damaging Het
Oxtr A T 6: 112,466,598 (GRCm39) probably null Het
Pgm2 A T 5: 64,269,490 (GRCm39) I526F possibly damaging Het
Plekho2 T C 9: 65,464,105 (GRCm39) D248G possibly damaging Het
Rab43 A T 6: 87,769,752 (GRCm39) Y151* probably null Het
Rbm19 A G 5: 120,264,269 (GRCm39) E343G probably benign Het
Rel A T 11: 23,692,439 (GRCm39) D531E probably benign Het
Rfx4 T A 10: 84,704,291 (GRCm39) V262E probably damaging Het
Ryr3 A G 2: 112,672,178 (GRCm39) L1431P probably damaging Het
Sdk2 A G 11: 113,729,271 (GRCm39) I1102T probably benign Het
Sema3d A C 5: 12,513,183 (GRCm39) D51A possibly damaging Het
Sh2d4a T A 8: 68,787,775 (GRCm39) F294I probably damaging Het
Slc3a1 A G 17: 85,367,171 (GRCm39) T453A probably benign Het
Sod1 A G 16: 90,022,071 (GRCm39) D93G probably benign Het
Stxbp4 A C 11: 90,512,526 (GRCm39) M1R probably null Het
Tbc1d7 A T 13: 43,318,812 (GRCm39) Y108* probably null Het
Ticam1 A T 17: 56,577,226 (GRCm39) V623D unknown Het
Ticam1 A G 17: 56,578,687 (GRCm39) L136P probably damaging Het
Tjap1 A C 17: 46,569,455 (GRCm39) W512G possibly damaging Het
Unc80 A T 1: 66,549,800 (GRCm39) Q686L possibly damaging Het
Wdr45b A T 11: 121,221,040 (GRCm39) F213I probably damaging Het
Xdh A C 17: 74,230,077 (GRCm39) W285G probably benign Het
Zfp646 C T 7: 127,482,982 (GRCm39) Q1500* probably null Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,883,968 (GRCm39) critical splice donor site probably null
IGL00932:Sptan1 APN 2 29,905,622 (GRCm39) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 29,890,083 (GRCm39) splice site probably benign
IGL01070:Sptan1 APN 2 29,904,185 (GRCm39) critical splice donor site probably null
IGL01625:Sptan1 APN 2 29,916,126 (GRCm39) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 29,908,491 (GRCm39) missense probably benign 0.12
IGL01795:Sptan1 APN 2 29,908,501 (GRCm39) missense probably benign 0.07
IGL01982:Sptan1 APN 2 29,909,980 (GRCm39) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 29,903,725 (GRCm39) missense probably benign 0.43
IGL02158:Sptan1 APN 2 29,920,336 (GRCm39) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 29,920,752 (GRCm39) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 29,906,067 (GRCm39) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 29,908,486 (GRCm39) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,888,195 (GRCm39) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,868,588 (GRCm39) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,886,055 (GRCm39) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,881,045 (GRCm39) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,876,505 (GRCm39) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 29,915,593 (GRCm39) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0094:Sptan1 UTSW 2 29,896,635 (GRCm39) missense probably benign 0.37
R0230:Sptan1 UTSW 2 29,900,704 (GRCm39) splice site probably benign
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,882,764 (GRCm39) splice site probably null
R0368:Sptan1 UTSW 2 29,883,927 (GRCm39) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,881,045 (GRCm39) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 29,918,684 (GRCm39) missense probably null
R0448:Sptan1 UTSW 2 29,916,822 (GRCm39) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 29,903,860 (GRCm39) splice site probably benign
R0580:Sptan1 UTSW 2 29,897,587 (GRCm39) missense probably damaging 0.99
R0739:Sptan1 UTSW 2 29,903,530 (GRCm39) missense probably damaging 1.00
R0924:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,870,075 (GRCm39) splice site probably null
R1352:Sptan1 UTSW 2 29,911,199 (GRCm39) splice site probably benign
R1456:Sptan1 UTSW 2 29,870,215 (GRCm39) critical splice donor site probably null
R1537:Sptan1 UTSW 2 29,916,034 (GRCm39) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 29,917,139 (GRCm39) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 29,893,348 (GRCm39) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,876,432 (GRCm39) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,882,013 (GRCm39) splice site probably benign
R1879:Sptan1 UTSW 2 29,885,540 (GRCm39) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 29,910,472 (GRCm39) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R1915:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R2022:Sptan1 UTSW 2 29,897,573 (GRCm39) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 29,892,250 (GRCm39) missense probably benign
R2103:Sptan1 UTSW 2 29,920,483 (GRCm39) missense probably damaging 1.00
R2162:Sptan1 UTSW 2 29,908,588 (GRCm39) splice site probably benign
R2931:Sptan1 UTSW 2 29,908,500 (GRCm39) missense probably benign
R3726:Sptan1 UTSW 2 29,908,431 (GRCm39) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 29,920,037 (GRCm39) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 29,916,600 (GRCm39) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 29,915,581 (GRCm39) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 29,919,721 (GRCm39) intron probably benign
R4718:Sptan1 UTSW 2 29,921,074 (GRCm39) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,886,447 (GRCm39) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 29,901,054 (GRCm39) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,868,455 (GRCm39) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5181:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5383:Sptan1 UTSW 2 29,901,340 (GRCm39) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,876,504 (GRCm39) nonsense probably null
R5592:Sptan1 UTSW 2 29,876,731 (GRCm39) intron probably benign
R5639:Sptan1 UTSW 2 29,881,005 (GRCm39) nonsense probably null
R5801:Sptan1 UTSW 2 29,920,613 (GRCm39) splice site probably null
R5947:Sptan1 UTSW 2 29,884,379 (GRCm39) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,886,794 (GRCm39) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,883,899 (GRCm39) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 29,894,535 (GRCm39) missense probably benign 0.01
R6254:Sptan1 UTSW 2 29,897,561 (GRCm39) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 29,908,527 (GRCm39) missense probably damaging 1.00
R6521:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 29,920,985 (GRCm39) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,873,221 (GRCm39) missense probably benign 0.02
R7248:Sptan1 UTSW 2 29,892,311 (GRCm39) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,876,941 (GRCm39) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,870,209 (GRCm39) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 29,890,068 (GRCm39) missense probably benign 0.06
R7779:Sptan1 UTSW 2 29,911,319 (GRCm39) missense probably damaging 1.00
R8051:Sptan1 UTSW 2 29,920,171 (GRCm39) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,884,351 (GRCm39) missense probably benign 0.22
R8103:Sptan1 UTSW 2 29,910,055 (GRCm39) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,870,212 (GRCm39) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 29,916,596 (GRCm39) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,873,744 (GRCm39) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 29,920,597 (GRCm39) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 29,920,724 (GRCm39) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,880,977 (GRCm39) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 29,910,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTACACCTGATACTACCTGAGAC -3'
(R):5'- CTTGGGAAGAAGGCTATTATCCAGCAC -3'

Sequencing Primer
(F):5'- ACCTGAGACCTACAGTCTCTGG -3'
(R):5'- TCTGAACCTATCTTACCATGAGGAC -3'
Posted On 2013-11-07