Incidental Mutation 'R0930:Cacna2d1'
ID80729
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16365862 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1045 (N1045D)
Ref Sequence ENSEMBL: ENSMUSP00000136260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably benign
Transcript: ENSMUST00000039370
AA Change: N1062D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: N1062D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078272
AA Change: N1043D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: N1043D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101581
AA Change: N1050D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: N1050D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115281
AA Change: N1045D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: N1045D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167946
AA Change: N1050D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: N1050D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180204
AA Change: N1045D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: N1045D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199236
Predicted Effect probably benign
Transcript: ENSMUST00000199704
AA Change: N1038D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: N1038D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 intron probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 unclassified probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCCCTCATACTTGAAGTGGTTCTGTTG -3'
(R):5'- TCAGTTTGAGTggatcgagatttggc -3'

Sequencing Primer
(F):5'- CTGTTGGCTTTGGCAAATGTAG -3'
(R):5'- AGGTGGCAACATATTTCCAGTG -3'
Posted On2013-11-07