Incidental Mutation 'R0930:Oxtr'
ID80746
Institutional Source Beutler Lab
Gene Symbol Oxtr
Ensembl Gene ENSMUSG00000049112
Gene Nameoxytocin receptor
SynonymsOTR
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0930 (G1)
Quality Score179
Status Not validated
Chromosome6
Chromosomal Location112473683-112489943 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 112489637 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053306] [ENSMUST00000204027]
Predicted Effect probably damaging
Transcript: ENSMUST00000053306
AA Change: L54Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051132
Gene: ENSMUSG00000049112
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:7tm_4 46 183 2.5e-8 PFAM
Pfam:7TM_GPCR_Srsx 50 339 1.4e-6 PFAM
Pfam:7tm_1 56 328 3.4e-46 PFAM
low complexity region 365 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204027
SMART Domains Protein: ENSMUSP00000145300
Gene: ENSMUSG00000049112

DomainStartEndE-ValueType
SCOP:d1l9ha_ 2 56 2e-6 SMART
Meta Mutation Damage Score 0.6319 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females fail to lactate and exhibit decreased maternal behavior. Males exhibit an increase in aggression, hypoactivity and vocalization in response to social isolation, and social amnesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Oxtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Oxtr APN 6 112477239 missense probably damaging 1.00
R0610:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0635:Oxtr UTSW 6 112489200 missense probably damaging 1.00
R0924:Oxtr UTSW 6 112489637 unclassified probably null
R0959:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0961:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1099:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1101:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1102:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1344:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1401:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1682:Oxtr UTSW 6 112477177 missense probably benign 0.08
R2254:Oxtr UTSW 6 112489106 missense probably damaging 0.98
R3424:Oxtr UTSW 6 112477230 missense probably benign 0.31
R3805:Oxtr UTSW 6 112477186 missense probably benign 0.14
R4598:Oxtr UTSW 6 112489752 missense probably benign 0.20
R5757:Oxtr UTSW 6 112477261 missense probably damaging 1.00
R5821:Oxtr UTSW 6 112489496 missense probably damaging 1.00
R6667:Oxtr UTSW 6 112477099 unclassified probably benign
Z1176:Oxtr UTSW 6 112489695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGACCAGACGACACAGCAGG -3'
(R):5'- TTTAAAGAGCCTCAAGGCCGGGTG -3'

Sequencing Primer
(F):5'- CGACACAGCAGGTCGGG -3'
(R):5'- GTGCTCCCTCAGGGTCG -3'
Posted On2013-11-07