Incidental Mutation 'R0930:Myo7a'
ID 80753
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Name myosin VIIA
Synonyms nmf371, USH1B, polka, Hdb, Myo7
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0930 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 97700267-97768731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97747463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 129 (I129N)
Ref Sequence ENSEMBL: ENSMUSP00000102739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627] [ENSMUST00000205746]
AlphaFold P97479
Predicted Effect possibly damaging
Transcript: ENSMUST00000084979
AA Change: I123N

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: I123N

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: I129N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: I129N

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107127
AA Change: I134N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: I134N

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107128
AA Change: I134N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: I134N

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect silent
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155637
Predicted Effect possibly damaging
Transcript: ENSMUST00000205746
AA Change: I123N

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153657
Meta Mutation Damage Score 0.9411 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G T 17: 84,990,705 (GRCm39) V16L probably benign Het
Adamts18 A T 8: 114,432,028 (GRCm39) probably null Het
Agpat4 A T 17: 12,417,723 (GRCm39) E88V probably damaging Het
Ahcyl2 A C 6: 29,870,627 (GRCm39) probably null Het
Ankrd2 T A 19: 42,032,292 (GRCm39) probably null Het
Anxa6 A T 11: 54,885,214 (GRCm39) probably null Het
Bpi A G 2: 158,103,346 (GRCm39) I114V possibly damaging Het
Cacna1c A T 6: 118,652,857 (GRCm39) I772N probably damaging Het
Cacna2d1 A G 5: 16,570,860 (GRCm39) N1045D possibly damaging Het
Caprin2 T C 6: 148,785,009 (GRCm39) probably null Het
Cars1 T A 7: 143,124,307 (GRCm39) H373L probably damaging Het
Ccdc191 G T 16: 43,751,618 (GRCm39) G316V probably damaging Het
Cd244a T A 1: 171,404,801 (GRCm39) probably null Het
Ces1a C T 8: 93,749,044 (GRCm39) D456N probably benign Het
Cul3 A T 1: 80,267,835 (GRCm39) M102K probably damaging Het
Dact1 A G 12: 71,365,234 (GRCm39) R672G probably damaging Het
Dapk1 T C 13: 60,905,262 (GRCm39) F991L probably benign Het
Dlg5 G A 14: 24,185,645 (GRCm39) P1920L probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Exosc4 A G 15: 76,211,734 (GRCm39) I14M probably benign Het
Ezr G A 17: 7,021,398 (GRCm39) R180* probably null Het
Fcgbpl1 A T 7: 27,839,555 (GRCm39) Y456F probably damaging Het
Fyb1 A T 15: 6,668,309 (GRCm39) I501F probably damaging Het
Hdac5 G T 11: 102,095,472 (GRCm39) P383Q probably benign Het
Hmx3 A T 7: 131,144,813 (GRCm39) H41L probably benign Het
Krt36 A G 11: 99,994,225 (GRCm39) F284S probably damaging Het
L1td1 A G 4: 98,625,862 (GRCm39) N686D probably damaging Het
Lsamp G A 16: 41,709,327 (GRCm39) G86S probably benign Het
Myh8 A G 11: 67,196,824 (GRCm39) E1819G possibly damaging Het
Nckap1 A T 2: 80,384,593 (GRCm39) C114S probably benign Het
Nphp4 T G 4: 152,622,512 (GRCm39) L599R probably benign Het
Nrcam A G 12: 44,596,667 (GRCm39) I301V probably benign Het
Or6b2b A G 1: 92,419,127 (GRCm39) S117P possibly damaging Het
Os9 C T 10: 126,932,924 (GRCm39) R547Q probably damaging Het
Oxtr A T 6: 112,466,598 (GRCm39) probably null Het
Pgm2 A T 5: 64,269,490 (GRCm39) I526F possibly damaging Het
Plekho2 T C 9: 65,464,105 (GRCm39) D248G possibly damaging Het
Rab43 A T 6: 87,769,752 (GRCm39) Y151* probably null Het
Rbm19 A G 5: 120,264,269 (GRCm39) E343G probably benign Het
Rel A T 11: 23,692,439 (GRCm39) D531E probably benign Het
Rfx4 T A 10: 84,704,291 (GRCm39) V262E probably damaging Het
Ryr3 A G 2: 112,672,178 (GRCm39) L1431P probably damaging Het
Sdk2 A G 11: 113,729,271 (GRCm39) I1102T probably benign Het
Sema3d A C 5: 12,513,183 (GRCm39) D51A possibly damaging Het
Sh2d4a T A 8: 68,787,775 (GRCm39) F294I probably damaging Het
Slc3a1 A G 17: 85,367,171 (GRCm39) T453A probably benign Het
Sod1 A G 16: 90,022,071 (GRCm39) D93G probably benign Het
Sptan1 A G 2: 29,906,040 (GRCm39) N1662S probably damaging Het
Stxbp4 A C 11: 90,512,526 (GRCm39) M1R probably null Het
Tbc1d7 A T 13: 43,318,812 (GRCm39) Y108* probably null Het
Ticam1 A T 17: 56,577,226 (GRCm39) V623D unknown Het
Ticam1 A G 17: 56,578,687 (GRCm39) L136P probably damaging Het
Tjap1 A C 17: 46,569,455 (GRCm39) W512G possibly damaging Het
Unc80 A T 1: 66,549,800 (GRCm39) Q686L possibly damaging Het
Wdr45b A T 11: 121,221,040 (GRCm39) F213I probably damaging Het
Xdh A C 17: 74,230,077 (GRCm39) W285G probably benign Het
Zfp646 C T 7: 127,482,982 (GRCm39) Q1500* probably null Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 97,751,833 (GRCm39) missense probably damaging 1.00
IGL00785:Myo7a APN 7 97,703,555 (GRCm39) missense probably damaging 0.99
IGL00840:Myo7a APN 7 97,700,866 (GRCm39) missense probably benign 0.25
IGL01362:Myo7a APN 7 97,746,909 (GRCm39) missense probably damaging 1.00
IGL01484:Myo7a APN 7 97,734,629 (GRCm39) missense probably damaging 1.00
IGL01673:Myo7a APN 7 97,703,915 (GRCm39) missense probably benign 0.00
IGL01933:Myo7a APN 7 97,732,349 (GRCm39) missense probably damaging 1.00
IGL01943:Myo7a APN 7 97,714,854 (GRCm39) missense possibly damaging 0.96
IGL02188:Myo7a APN 7 97,740,234 (GRCm39) missense probably damaging 0.96
IGL02304:Myo7a APN 7 97,726,943 (GRCm39) missense possibly damaging 0.89
IGL02305:Myo7a APN 7 97,700,836 (GRCm39) makesense probably null
IGL02331:Myo7a APN 7 97,702,389 (GRCm39) missense possibly damaging 0.95
IGL02386:Myo7a APN 7 97,724,319 (GRCm39) missense probably damaging 0.99
IGL02389:Myo7a APN 7 97,756,198 (GRCm39) critical splice donor site probably null
IGL02832:Myo7a APN 7 97,740,227 (GRCm39) critical splice donor site probably null
IGL02839:Myo7a APN 7 97,740,329 (GRCm39) missense probably damaging 1.00
IGL03193:Myo7a APN 7 97,740,264 (GRCm39) missense probably damaging 1.00
IGL03237:Myo7a APN 7 97,751,800 (GRCm39) missense probably damaging 1.00
IGL03384:Myo7a APN 7 97,742,800 (GRCm39) missense probably damaging 1.00
coward UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
H8786:Myo7a UTSW 7 97,744,985 (GRCm39) missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 97,728,534 (GRCm39) missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 97,705,974 (GRCm39) missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 97,712,806 (GRCm39) missense probably benign 0.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0267:Myo7a UTSW 7 97,703,831 (GRCm39) missense probably benign 0.08
R0408:Myo7a UTSW 7 97,705,988 (GRCm39) missense probably damaging 1.00
R0411:Myo7a UTSW 7 97,721,144 (GRCm39) missense probably benign 0.00
R0540:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0607:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0629:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R0632:Myo7a UTSW 7 97,761,357 (GRCm39) intron probably benign
R0659:Myo7a UTSW 7 97,703,545 (GRCm39) splice site probably benign
R0735:Myo7a UTSW 7 97,730,387 (GRCm39) splice site probably benign
R0924:Myo7a UTSW 7 97,747,463 (GRCm39) missense probably damaging 0.99
R1018:Myo7a UTSW 7 97,756,212 (GRCm39) missense probably damaging 1.00
R1196:Myo7a UTSW 7 97,746,880 (GRCm39) missense possibly damaging 0.87
R1331:Myo7a UTSW 7 97,756,215 (GRCm39) missense probably benign 0.00
R1487:Myo7a UTSW 7 97,703,017 (GRCm39) critical splice donor site probably null
R1676:Myo7a UTSW 7 97,748,679 (GRCm39) critical splice donor site probably null
R1695:Myo7a UTSW 7 97,741,703 (GRCm39) missense possibly damaging 0.94
R1770:Myo7a UTSW 7 97,761,813 (GRCm39) intron probably benign
R1781:Myo7a UTSW 7 97,722,331 (GRCm39) missense probably damaging 1.00
R1789:Myo7a UTSW 7 97,756,302 (GRCm39) missense probably damaging 0.99
R1827:Myo7a UTSW 7 97,725,938 (GRCm39) missense probably damaging 0.99
R1864:Myo7a UTSW 7 97,701,463 (GRCm39) missense probably damaging 1.00
R1955:Myo7a UTSW 7 97,704,128 (GRCm39) missense probably damaging 1.00
R2011:Myo7a UTSW 7 97,703,915 (GRCm39) missense possibly damaging 0.69
R2229:Myo7a UTSW 7 97,704,117 (GRCm39) missense probably benign 0.12
R2259:Myo7a UTSW 7 97,718,706 (GRCm39) missense probably damaging 1.00
R2443:Myo7a UTSW 7 97,744,976 (GRCm39) missense probably benign 0.07
R2898:Myo7a UTSW 7 97,746,413 (GRCm39) missense probably damaging 1.00
R2898:Myo7a UTSW 7 97,703,631 (GRCm39) nonsense probably null
R3158:Myo7a UTSW 7 97,701,499 (GRCm39) missense probably damaging 1.00
R3408:Myo7a UTSW 7 97,730,294 (GRCm39) missense probably benign 0.00
R4222:Myo7a UTSW 7 97,722,436 (GRCm39) missense possibly damaging 0.93
R4255:Myo7a UTSW 7 97,721,171 (GRCm39) missense probably damaging 0.96
R4374:Myo7a UTSW 7 97,751,881 (GRCm39) missense probably damaging 1.00
R4429:Myo7a UTSW 7 97,702,395 (GRCm39) missense probably damaging 0.99
R4445:Myo7a UTSW 7 97,715,611 (GRCm39) missense probably damaging 1.00
R4579:Myo7a UTSW 7 97,722,400 (GRCm39) missense probably damaging 1.00
R4659:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R5073:Myo7a UTSW 7 97,722,425 (GRCm39) nonsense probably null
R5138:Myo7a UTSW 7 97,732,806 (GRCm39) missense probably damaging 1.00
R5566:Myo7a UTSW 7 97,714,023 (GRCm39) missense possibly damaging 0.93
R5580:Myo7a UTSW 7 97,722,367 (GRCm39) missense probably damaging 1.00
R6079:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6138:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6451:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6452:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6453:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6454:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6455:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6465:Myo7a UTSW 7 97,711,887 (GRCm39) missense possibly damaging 0.95
R6653:Myo7a UTSW 7 97,703,710 (GRCm39) missense probably damaging 0.96
R6709:Myo7a UTSW 7 97,703,906 (GRCm39) missense probably damaging 1.00
R6917:Myo7a UTSW 7 97,744,970 (GRCm39) missense possibly damaging 0.58
R7313:Myo7a UTSW 7 97,713,402 (GRCm39) missense probably damaging 0.99
R7334:Myo7a UTSW 7 97,728,573 (GRCm39) missense probably benign
R7356:Myo7a UTSW 7 97,751,890 (GRCm39) missense probably benign 0.01
R7393:Myo7a UTSW 7 97,712,906 (GRCm39) missense possibly damaging 0.91
R7422:Myo7a UTSW 7 97,700,833 (GRCm39) splice site probably null
R7472:Myo7a UTSW 7 97,714,000 (GRCm39) missense probably damaging 1.00
R7483:Myo7a UTSW 7 97,712,881 (GRCm39) missense probably benign 0.07
R7526:Myo7a UTSW 7 97,734,655 (GRCm39) missense possibly damaging 0.49
R7948:Myo7a UTSW 7 97,724,236 (GRCm39) missense probably damaging 1.00
R8069:Myo7a UTSW 7 97,732,833 (GRCm39) nonsense probably null
R8115:Myo7a UTSW 7 97,715,653 (GRCm39) missense probably damaging 0.98
R8150:Myo7a UTSW 7 97,712,846 (GRCm39) missense probably benign 0.19
R8265:Myo7a UTSW 7 97,734,604 (GRCm39) missense probably benign 0.00
R8289:Myo7a UTSW 7 97,726,376 (GRCm39) missense probably benign
R8298:Myo7a UTSW 7 97,747,541 (GRCm39) missense probably damaging 1.00
R8518:Myo7a UTSW 7 97,740,270 (GRCm39) missense possibly damaging 0.58
R8539:Myo7a UTSW 7 97,721,668 (GRCm39) missense probably damaging 0.99
R8557:Myo7a UTSW 7 97,703,081 (GRCm39) missense probably benign 0.08
R8685:Myo7a UTSW 7 97,746,334 (GRCm39) missense probably benign 0.03
R8902:Myo7a UTSW 7 97,741,820 (GRCm39) missense probably damaging 1.00
R9034:Myo7a UTSW 7 97,728,465 (GRCm39) missense probably benign 0.40
R9090:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9172:Myo7a UTSW 7 97,732,369 (GRCm39) missense probably benign
R9271:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9334:Myo7a UTSW 7 97,716,369 (GRCm39) missense probably damaging 1.00
R9356:Myo7a UTSW 7 97,725,873 (GRCm39) missense probably benign 0.11
R9444:Myo7a UTSW 7 97,742,698 (GRCm39) missense possibly damaging 0.84
R9459:Myo7a UTSW 7 97,722,380 (GRCm39) missense possibly damaging 0.65
R9513:Myo7a UTSW 7 97,746,818 (GRCm39) critical splice donor site probably null
R9517:Myo7a UTSW 7 97,721,166 (GRCm39) missense probably damaging 1.00
R9629:Myo7a UTSW 7 97,712,937 (GRCm39) missense probably benign 0.03
R9662:Myo7a UTSW 7 97,747,499 (GRCm39) missense possibly damaging 0.55
R9709:Myo7a UTSW 7 97,743,536 (GRCm39) missense possibly damaging 0.79
RF005:Myo7a UTSW 7 97,742,824 (GRCm39) missense probably benign 0.42
U15987:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
X0028:Myo7a UTSW 7 97,714,932 (GRCm39) missense probably damaging 1.00
X0058:Myo7a UTSW 7 97,711,855 (GRCm39) missense probably benign 0.02
Z1176:Myo7a UTSW 7 97,744,934 (GRCm39) missense probably damaging 0.98
Z1177:Myo7a UTSW 7 97,734,730 (GRCm39) critical splice acceptor site probably null
Z1177:Myo7a UTSW 7 97,701,433 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCCTTGCCCAAGAGCAAAG -3'
(R):5'- AAGGCCAGTCTGAGACCCTTCATC -3'

Sequencing Primer
(F):5'- GGGGTGACTCCATACACTATGAC -3'
(R):5'- TCTGTGGACTCCAGAGCTG -3'
Posted On 2013-11-07