Incidental Mutation 'R0930:Zfp646'
ID80755
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 127883810 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1500 (Q1500*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000121394] [ENSMUST00000131000] [ENSMUST00000205300]
Predicted Effect probably null
Transcript: ENSMUST00000050383
AA Change: Q1720*
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: Q1720*

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121394
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131000
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect probably null
Transcript: ENSMUST00000206340
AA Change: Q1500*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127881304 missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R1219:Zfp646 UTSW 7 127883120 missense probably benign
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127880187 unclassified probably null
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127880038 nonsense probably null
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127883477 missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
Z1177:Zfp646 UTSW 7 127880632 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAGGAGCGTCCCTTTTGCTGTG -3'
(R):5'- AGCTAGATGGTCAGTCCATGTCCAG -3'

Sequencing Primer
(F):5'- GTAGCCTGCTGAACCACCAG -3'
(R):5'- CCTCAGGCTCCACTTGAC -3'
Posted On2013-11-07