Mutagenetix > Incidental Mutation

Incidental Mutation 'R0883:Hspg2'

80756

Institutional Source

Beutler Lab

Gene Symbol

Hspg2

Ensembl Gene

ENSMUSG00000028763

Gene Name

perlecan (heparan sulfate proteoglycan 2)

Synonyms

Plc, Pcn, per

MMRRC Submission

039050-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137468769-137570630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 137541440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2157 (S2157P)

Ref Sequence

ENSEMBL: ENSMUSP00000131316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030547
AA Change: S2151P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: S2151P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1113	1156	7.5e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2056	2117	4.81e-15	SMART
IGc2	2157	2216	1.37e-10	SMART
IGc2	2251	2312	5.88e-10	SMART
low complexity region	2333	2344	N/A	INTRINSIC
IGc2	2347	2408	1.97e-11	SMART
IGc2	2441	2502	1.59e-15	SMART
low complexity region	2517	2528	N/A	INTRINSIC
IGc2	2538	2599	3.08e-13	SMART
IGc2	2634	2695	9.25e-17	SMART
low complexity region	2704	2728	N/A	INTRINSIC
IGc2	2731	2792	1.84e-11	SMART
IGc2	2828	2889	2.11e-11	SMART
IGc2	2926	2987	3.25e-12	SMART
IG	3017	3098	3.62e-10	SMART
IGc2	3114	3180	9.05e-11	SMART
IGc2	3212	3273	2.44e-16	SMART
IGc2	3299	3360	2.26e-11	SMART
IGc2	3400	3461	6.81e-6	SMART
IGc2	3489	3550	1.59e-15	SMART
IGc2	3575	3636	2.54e-14	SMART
LamG	3672	3813	3.41e-39	SMART
EGF	3832	3866	6.91e-9	SMART
EGF	3872	3907	4.46e-3	SMART
LamG	3934	4070	4.78e-43	SMART
EGF	4092	4126	1.17e-6	SMART
EGF	4131	4161	1.87e-5	SMART
LamG	4211	4348	1.33e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171332
AA Change: S2157P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: S2157P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1114	1156	7.9e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2062	2123	4.81e-15	SMART
IGc2	2163	2222	1.37e-10	SMART
IGc2	2257	2318	5.88e-10	SMART
low complexity region	2339	2350	N/A	INTRINSIC
IGc2	2353	2414	1.97e-11	SMART
IGc2	2447	2508	1.59e-15	SMART
low complexity region	2523	2534	N/A	INTRINSIC
IGc2	2544	2605	3.08e-13	SMART
IGc2	2640	2701	9.25e-17	SMART
low complexity region	2710	2734	N/A	INTRINSIC
IGc2	2737	2798	1.84e-11	SMART
IGc2	2836	2897	2.11e-11	SMART
IGc2	2934	2995	3.25e-12	SMART
IG	3025	3106	3.62e-10	SMART
IGc2	3122	3188	9.05e-11	SMART
IGc2	3220	3281	2.44e-16	SMART
IGc2	3307	3368	2.26e-11	SMART
IGc2	3408	3469	6.81e-6	SMART
IGc2	3497	3558	1.59e-15	SMART
IGc2	3583	3644	2.54e-14	SMART
LamG	3680	3821	3.41e-39	SMART
EGF	3840	3874	6.91e-9	SMART
EGF	3880	3915	4.46e-3	SMART
LamG	3942	4078	4.78e-43	SMART
EGF	4100	4134	1.17e-6	SMART
EGF	4139	4169	1.87e-5	SMART
LamG	4219	4356	1.33e-41	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184284

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

98% (148/151)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 150 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
4930595M18Rik	G	T	X: 81,420,931	T390N	possibly damaging	Het
Abca13	C	T	11: 9,291,238	Q1034*	probably null	Het
Adgra3	T	C	5: 49,960,723	H1161R	probably damaging	Het
AF529169	T	C	9: 89,602,417	H309R	probably benign	Het
Aff1	T	C	5: 103,826,138		probably benign	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Ankrd12	A	G	17: 65,985,132	V1102A	probably benign	Het
Ankrd54	A	T	15: 79,062,731	C23S	probably damaging	Het
Anxa10	C	T	8: 62,077,967	V70I	probably benign	Het
Asap3	T	C	4: 136,234,325		probably benign	Het
Asb13	T	C	13: 3,645,052		probably null	Het
Atp6v1a	A	T	16: 44,101,692		probably benign	Het
Atp8b1	T	G	18: 64,564,541	I411L	probably benign	Het
Baiap3	T	A	17: 25,249,101	N313I	probably damaging	Het
Bok	T	C	1: 93,686,487	I14T	probably benign	Het
Bri3bp	T	A	5: 125,441,744		probably null	Het
C2cd2l	A	G	9: 44,316,202	L186P	probably damaging	Het
Cadm2	A	T	16: 66,882,814	C44S	probably damaging	Het
Capn11	T	C	17: 45,638,881		probably benign	Het
Carm1	T	A	9: 21,569,591		probably benign	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Ccdc27	T	C	4: 154,036,484	E285G	unknown	Het
Cct3	T	A	3: 88,313,557	D298E	probably damaging	Het
Cd59b	T	A	2: 104,080,986		probably benign	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Celsr3	T	A	9: 108,842,633	I2470N	probably damaging	Het
Cfap100	G	A	6: 90,415,906		probably benign	Het
Cfap45	A	T	1: 172,532,189	R98S	possibly damaging	Het
Cfap54	T	A	10: 92,870,669	H2757L	unknown	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Cntn4	A	T	6: 106,667,540		probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Daam2	A	T	17: 49,498,883		probably benign	Het
Ddias	A	T	7: 92,859,337	W457R	probably benign	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Dhx57	T	C	17: 80,270,371	T570A	probably damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Dtymk	C	T	1: 93,801,788	V14M	possibly damaging	Het
Dync2li1	G	A	17: 84,649,271	M286I	probably benign	Het
Eea1	G	A	10: 96,021,667	D664N	possibly damaging	Het
Esp6	G	T	17: 40,565,396	V112L	probably benign	Het
Fam83h	G	T	15: 76,006,169	Q127K	probably damaging	Het
Gabbr2	G	A	4: 46,677,474	T802I	probably benign	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm4907	A	T	X: 23,907,051	I264F	probably benign	Het
Gm5941	G	A	X: 92,490,211	A62T	possibly damaging	Het
Gng2	G	T	14: 19,891,295	D26E	probably benign	Het
Gpr33	A	G	12: 52,023,635	V207A	probably benign	Het
Gstm3	T	A	3: 107,966,270		probably benign	Het
Havcr1	T	C	11: 46,752,432	C60R	probably damaging	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Igsf8	C	A	1: 172,316,259	A56D	possibly damaging	Het
Kat6a	G	T	8: 22,862,214	A5S	probably damaging	Het
Kctd16	A	G	18: 40,530,775	E319G	probably damaging	Het
Kmo	T	C	1: 175,647,140	V157A	possibly damaging	Het
Lrp5	T	A	19: 3,605,308	I1071F	probably damaging	Het
Lrrc17	A	G	5: 21,561,278	T253A	probably benign	Het
Mast2	T	A	4: 116,311,767	H769L	probably damaging	Het
Mast4	T	C	13: 102,853,900	K50E	probably damaging	Het
Mbd5	A	G	2: 49,256,689	T304A	possibly damaging	Het
Mbp	T	C	18: 82,572,870	S73P	probably damaging	Het
Mc5r	T	A	18: 68,339,092	V174E	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mlh3	C	G	12: 85,235,714	A1382P	possibly damaging	Het
Mpdz	T	C	4: 81,359,991		probably benign	Het
Muc5ac	A	G	7: 141,796,265	T582A	possibly damaging	Het
Mum1l1	T	A	X: 139,235,695	D327E	probably damaging	Het
Nalcn	A	G	14: 123,464,740	F453S	probably damaging	Het
Nrap	T	A	19: 56,345,474	M902L	probably damaging	Het
Nup85	C	T	11: 115,568,370	R100*	probably null	Het
Nxf1	T	G	19: 8,764,591	N296K	probably damaging	Het
Ogg1	A	G	6: 113,328,420	T65A	probably damaging	Het
Ogt	A	G	X: 101,644,199		probably benign	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr504	T	A	7: 108,565,276	N173I	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Ovol2	T	C	2: 144,331,790	D24G	probably damaging	Het
Pabpc1	A	G	15: 36,599,054		probably benign	Het
Pak6	T	C	2: 118,693,687	L441P	probably damaging	Het
Pappa	T	A	4: 65,189,315	C654*	probably null	Het
Paqr6	T	A	3: 88,365,991	S97T	probably damaging	Het
Parp14	T	C	16: 35,858,518	N360S	probably benign	Het
Pclo	G	T	5: 14,677,859	G2244*	probably null	Het
Pdzrn3	A	T	6: 101,155,942		probably null	Het
Pes1	T	C	11: 3,975,557	M220T	probably damaging	Het
Phip	A	T	9: 82,876,221	V1473E	probably benign	Het
Pkd2l2	T	A	18: 34,430,268		probably null	Het
Plch1	T	C	3: 63,753,256	D302G	probably damaging	Het
Plekhh2	A	G	17: 84,618,031	T1419A	probably benign	Het
Ppara	A	T	15: 85,798,171	E356V	probably damaging	Het
Ppp1r37	G	A	7: 19,532,177	P555S	probably benign	Het
Ppp6r1	T	C	7: 4,639,710	E545G	possibly damaging	Het
Proser3	G	A	7: 30,540,699	H327Y	probably damaging	Het
Prss43	T	A	9: 110,829,508	I292N	probably damaging	Het
Pygl	G	C	12: 70,206,404	N271K	probably damaging	Het
Rassf7	T	A	7: 141,216,990		probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Rspo1	T	A	4: 124,991,432		probably null	Het
Sav1	A	C	12: 69,966,205	L366V	probably benign	Het
Sema3b	T	G	9: 107,604,156	T52P	possibly damaging	Het
Senp6	A	G	9: 80,116,559	D40G	probably damaging	Het
Sh3pxd2a	A	G	19: 47,268,207	S719P	probably damaging	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Slc34a3	G	T	2: 25,231,233	D307E	probably benign	Het
Slc35b3	T	C	13: 38,937,275	I330V	probably benign	Het
Slc4a10	G	A	2: 62,243,398	C268Y	probably benign	Het
Slco6d1	A	G	1: 98,421,399	E65G	probably benign	Het
Slit2	A	G	5: 48,245,573		probably benign	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Snap47	A	G	11: 59,438,500		probably benign	Het
Snrnp25	G	A	11: 32,206,960	V15I	probably damaging	Het
Spns2	T	C	11: 72,454,397	Y449C	probably damaging	Het
Stab2	T	A	10: 86,924,450		probably benign	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tbc1d2	T	A	4: 46,609,003	K745*	probably null	Het
Tctn1	T	C	5: 122,264,144	T76A	probably damaging	Het
Tfpi	T	C	2: 84,443,320		probably benign	Het
Timm44	A	T	8: 4,266,592	H317Q	probably benign	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Tnpo3	A	T	6: 29,554,993		probably benign	Het
Top3b	T	C	16: 16,879,437		probably benign	Het
Trak1	T	A	9: 121,453,285	M410K	possibly damaging	Het
Trpm3	C	A	19: 22,978,654	P1160Q	probably damaging	Het
Tyk2	T	A	9: 21,111,137	T799S	possibly damaging	Het
Ubfd1	G	A	7: 122,067,491		probably benign	Het
Unc13a	G	A	8: 71,642,173	R1272*	probably null	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Urb2	C	T	8: 124,030,970	Q1139*	probably null	Het
Vmn2r66	A	T	7: 85,007,862	S112T	probably benign	Het
Vmn2r71	A	T	7: 85,623,634	D552V	probably benign	Het
Vmn2r76	A	G	7: 86,228,696	Y498H	probably benign	Het
Vmn2r84	A	C	10: 130,391,115	W285G	probably damaging	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Yaf2	T	C	15: 93,285,536	K131R	probably damaging	Het
Zfp141	A	T	7: 42,476,056	Y331N	possibly damaging	Het
Zfp324	G	T	7: 12,971,024	C380F	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Hspg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hspg2	APN	4	137528820	missense	probably damaging	1.00
IGL00339:Hspg2	APN	4	137539195	missense	probably damaging	1.00
IGL00943:Hspg2	APN	4	137562201	missense	probably benign	0.15
IGL00970:Hspg2	APN	4	137542590	missense	probably benign	0.09
IGL01011:Hspg2	APN	4	137559335	missense	probably damaging	1.00
IGL01148:Hspg2	APN	4	137546658	missense	probably benign	0.11
IGL01333:Hspg2	APN	4	137540314	missense	probably damaging	1.00
IGL01367:Hspg2	APN	4	137538489	missense	probably damaging	1.00
IGL01455:Hspg2	APN	4	137553817	missense	probably damaging	1.00
IGL01540:Hspg2	APN	4	137519706	missense	probably damaging	1.00
IGL01578:Hspg2	APN	4	137539183	missense	probably damaging	1.00
IGL01603:Hspg2	APN	4	137552803	missense	probably damaging	1.00
IGL01632:Hspg2	APN	4	137514773	missense	probably damaging	1.00
IGL01658:Hspg2	APN	4	137564926	missense	probably damaging	1.00
IGL01760:Hspg2	APN	4	137512671	missense	possibly damaging	0.60
IGL01976:Hspg2	APN	4	137561926	missense	probably damaging	1.00
IGL02024:Hspg2	APN	4	137540073	missense	probably damaging	1.00
IGL02033:Hspg2	APN	4	137552254	missense	probably benign
IGL02051:Hspg2	APN	4	137568389	unclassified	probably benign
IGL02124:Hspg2	APN	4	137518814	splice site	probably null
IGL02128:Hspg2	APN	4	137564016	missense	probably damaging	1.00
IGL02177:Hspg2	APN	4	137515316	missense	probably damaging	1.00
IGL02230:Hspg2	APN	4	137518645	missense	probably damaging	1.00
IGL02266:Hspg2	APN	4	137510577	missense	probably damaging	1.00
IGL02313:Hspg2	APN	4	137508389	missense	probably benign	0.03
IGL02477:Hspg2	APN	4	137544512	splice site	probably benign
IGL02514:Hspg2	APN	4	137569576	missense	probably benign	0.09
IGL02613:Hspg2	APN	4	137544420	missense	probably damaging	1.00
IGL02625:Hspg2	APN	4	137512642	missense	probably damaging	1.00
IGL02646:Hspg2	APN	4	137551848	missense	possibly damaging	0.60
IGL02651:Hspg2	APN	4	137557445	splice site	probably benign
IGL02701:Hspg2	APN	4	137557174	missense	probably damaging	0.96
IGL02833:Hspg2	APN	4	137555130	missense	probably benign	0.00
IGL02985:Hspg2	APN	4	137507803	missense	probably damaging	1.00
IGL03040:Hspg2	APN	4	137561825	critical splice donor site	probably null
IGL03181:Hspg2	APN	4	137515937	missense	probably damaging	1.00
IGL03349:Hspg2	APN	4	137560522	splice site	probably benign
G1patch:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
PIT4305001:Hspg2	UTSW	4	137550373	missense	possibly damaging	0.55
R0006:Hspg2	UTSW	4	137519931	missense	probably damaging	1.00
R0036:Hspg2	UTSW	4	137542849	missense	probably damaging	1.00
R0109:Hspg2	UTSW	4	137562201	missense	probably benign	0.15
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0132:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0245:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0388:Hspg2	UTSW	4	137511158	missense	probably damaging	1.00
R0389:Hspg2	UTSW	4	137515423	missense	possibly damaging	0.53
R0468:Hspg2	UTSW	4	137533529	missense	probably damaging	1.00
R0480:Hspg2	UTSW	4	137550024	missense	probably damaging	1.00
R0546:Hspg2	UTSW	4	137502294	missense	probably benign
R0599:Hspg2	UTSW	4	137512401	missense	probably damaging	0.98
R0652:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0671:Hspg2	UTSW	4	137553280	missense	probably damaging	1.00
R0760:Hspg2	UTSW	4	137512349	missense	probably damaging	1.00
R1403:Hspg2	UTSW	4	137540100	missense	possibly damaging	0.90
R1417:Hspg2	UTSW	4	137517636	missense	probably benign
R1497:Hspg2	UTSW	4	137548096	missense	probably damaging	0.98
R1509:Hspg2	UTSW	4	137511241	splice site	probably benign
R1625:Hspg2	UTSW	4	137518971	missense	probably benign	0.23
R1630:Hspg2	UTSW	4	137518435	missense	probably damaging	1.00
R1651:Hspg2	UTSW	4	137533437	nonsense	probably null
R1699:Hspg2	UTSW	4	137548012	splice site	probably null
R1703:Hspg2	UTSW	4	137559151	missense	probably damaging	1.00
R1761:Hspg2	UTSW	4	137514673	missense	possibly damaging	0.90
R1775:Hspg2	UTSW	4	137520156	missense	probably damaging	0.99
R1779:Hspg2	UTSW	4	137518509	missense	probably damaging	1.00
R1843:Hspg2	UTSW	4	137545567	missense	probably damaging	1.00
R1891:Hspg2	UTSW	4	137565490	missense	probably damaging	1.00
R1930:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1931:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1942:Hspg2	UTSW	4	137542552	missense	possibly damaging	0.67
R1959:Hspg2	UTSW	4	137564895	missense	probably damaging	1.00
R2042:Hspg2	UTSW	4	137568366	missense	probably damaging	1.00
R2062:Hspg2	UTSW	4	137559367	missense	possibly damaging	0.79
R2098:Hspg2	UTSW	4	137520109	missense	probably damaging	1.00
R2158:Hspg2	UTSW	4	137517604	missense	probably damaging	1.00
R2280:Hspg2	UTSW	4	137522043	missense	probably damaging	1.00
R2890:Hspg2	UTSW	4	137549574	missense	probably damaging	1.00
R2927:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R3428:Hspg2	UTSW	4	137555290	missense	probably damaging	1.00
R3744:Hspg2	UTSW	4	137565504	splice site	probably benign
R3873:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3874:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3917:Hspg2	UTSW	4	137559314	missense	probably damaging	1.00
R3932:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R3933:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R4134:Hspg2	UTSW	4	137556657	missense	probably damaging	0.99
R4272:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4273:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4274:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4275:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4288:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4289:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4354:Hspg2	UTSW	4	137468911	missense	probably benign	0.17
R4355:Hspg2	UTSW	4	137529418	missense	probably damaging	0.98
R4400:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4411:Hspg2	UTSW	4	137562224	missense	probably benign
R4421:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4592:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137539575	missense	possibly damaging	0.80
R4619:Hspg2	UTSW	4	137546573	missense	probably damaging	1.00
R4658:Hspg2	UTSW	4	137533730	missense	probably damaging	1.00
R4667:Hspg2	UTSW	4	137539645	missense	possibly damaging	0.90
R4724:Hspg2	UTSW	4	137522127	missense	probably damaging	0.96
R4739:Hspg2	UTSW	4	137570073	unclassified	probably benign
R4793:Hspg2	UTSW	4	137529473	missense	possibly damaging	0.95
R4826:Hspg2	UTSW	4	137565395	missense	probably damaging	1.00
R4838:Hspg2	UTSW	4	137541666	missense	possibly damaging	0.53
R4896:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4926:Hspg2	UTSW	4	137542530	missense	probably damaging	1.00
R4939:Hspg2	UTSW	4	137508031	missense	probably damaging	1.00
R5032:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5033:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5071:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5072:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5114:Hspg2	UTSW	4	137511926	missense	probably damaging	1.00
R5177:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R5223:Hspg2	UTSW	4	137543914	missense	probably damaging	1.00
R5433:Hspg2	UTSW	4	137528794	splice site	probably null
R5529:Hspg2	UTSW	4	137551828	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137520551	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137542825	missense	probably benign	0.17
R5546:Hspg2	UTSW	4	137548174	critical splice donor site	probably null
R5728:Hspg2	UTSW	4	137542766	missense	possibly damaging	0.95
R5764:Hspg2	UTSW	4	137561721	missense	probably damaging	1.00
R5920:Hspg2	UTSW	4	137553782	missense	probably damaging	1.00
R5934:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R6074:Hspg2	UTSW	4	137540735	missense	probably benign
R6164:Hspg2	UTSW	4	137514655	missense	possibly damaging	0.89
R6175:Hspg2	UTSW	4	137569518	missense	probably damaging	1.00
R6217:Hspg2	UTSW	4	137540248	missense	probably damaging	0.99
R6262:Hspg2	UTSW	4	137519686	missense	probably damaging	1.00
R6299:Hspg2	UTSW	4	137544705	missense	probably damaging	1.00
R6333:Hspg2	UTSW	4	137561955	missense	probably damaging	1.00
R6371:Hspg2	UTSW	4	137541695	missense	probably damaging	1.00
R6430:Hspg2	UTSW	4	137539396	missense	probably damaging	1.00
R6498:Hspg2	UTSW	4	137507801	missense	possibly damaging	0.46
R6522:Hspg2	UTSW	4	137555275	missense	probably damaging	1.00
R6680:Hspg2	UTSW	4	137565737	missense	probably benign	0.18
R6724:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6725:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6762:Hspg2	UTSW	4	137551803	missense	possibly damaging	0.83
R6785:Hspg2	UTSW	4	137508398	missense	probably damaging	0.99
R6788:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6931:Hspg2	UTSW	4	137540720	missense	probably damaging	1.00
R6959:Hspg2	UTSW	4	137519289	missense	probably benign	0.45
R6968:Hspg2	UTSW	4	137535156	missense	probably damaging	1.00
R6988:Hspg2	UTSW	4	137528890	missense	probably damaging	1.00
R7021:Hspg2	UTSW	4	137542269	missense	possibly damaging	0.69
R7089:Hspg2	UTSW	4	137544366	missense	possibly damaging	0.51
R7107:Hspg2	UTSW	4	137510652	missense	probably damaging	1.00
R7141:Hspg2	UTSW	4	137552116	missense	probably damaging	1.00
R7161:Hspg2	UTSW	4	137514719	missense	probably damaging	1.00
R7189:Hspg2	UTSW	4	137533561	critical splice donor site	probably null
R7238:Hspg2	UTSW	4	137508393	missense	probably damaging	1.00
R7253:Hspg2	UTSW	4	137519946	missense	probably benign	0.15
R7278:Hspg2	UTSW	4	137551125	missense	probably damaging	0.98
R7287:Hspg2	UTSW	4	137529556	missense	probably benign	0.00
R7390:Hspg2	UTSW	4	137539179	missense	probably damaging	1.00
R7436:Hspg2	UTSW	4	137515664	missense	probably damaging	0.99
R7479:Hspg2	UTSW	4	137539403	missense	probably benign	0.17
R7516:Hspg2	UTSW	4	137542620	missense	possibly damaging	0.94
R7540:Hspg2	UTSW	4	137541440	missense	possibly damaging	0.51
R7603:Hspg2	UTSW	4	137548368	missense	probably damaging	1.00
R7603:Hspg2	UTSW	4	137557192	missense	possibly damaging	0.91
R7625:Hspg2	UTSW	4	137564938	missense	probably damaging	1.00
R7696:Hspg2	UTSW	4	137511966	missense	possibly damaging	0.78
R7767:Hspg2	UTSW	4	137511866	missense	probably damaging	1.00
R7815:Hspg2	UTSW	4	137512464	missense	probably damaging	1.00
R7825:Hspg2	UTSW	4	137558849	missense	probably damaging	1.00
R7863:Hspg2	UTSW	4	137564824	missense	probably benign	0.03
R7885:Hspg2	UTSW	4	137516837	missense	probably damaging	1.00
R7899:Hspg2	UTSW	4	137548116	missense	possibly damaging	0.72
R7937:Hspg2	UTSW	4	137550932	missense	probably benign	0.01
R7975:Hspg2	UTSW	4	137555221	missense	probably benign	0.26
R8078:Hspg2	UTSW	4	137508022	missense	probably damaging	1.00
R8285:Hspg2	UTSW	4	137512663	missense	probably benign	0.18
R8314:Hspg2	UTSW	4	137539675	missense	probably benign	0.12
R8322:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8323:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8324:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8341:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8383:Hspg2	UTSW	4	137544370	missense	possibly damaging	0.66
R8425:Hspg2	UTSW	4	137550867	nonsense	probably null
R8491:Hspg2	UTSW	4	137553719	missense	probably benign	0.00
R8525:Hspg2	UTSW	4	137539448	missense	probably damaging	0.98
R8978:Hspg2	UTSW	4	137564030	missense	probably benign	0.09
R9152:Hspg2	UTSW	4	137522565	missense	possibly damaging	0.89
R9166:Hspg2	UTSW	4	137542874	missense	probably damaging	1.00
R9175:Hspg2	UTSW	4	137529346	missense	probably damaging	0.98
R9210:Hspg2	UTSW	4	137562479	missense	probably benign	0.05
R9221:Hspg2	UTSW	4	137560415	missense	possibly damaging	0.79
R9325:Hspg2	UTSW	4	137538241	missense	probably damaging	1.00
R9339:Hspg2	UTSW	4	137551169	missense	probably benign
R9340:Hspg2	UTSW	4	137569516	missense	probably damaging	1.00
R9358:Hspg2	UTSW	4	137517598	missense	probably damaging	1.00
R9451:Hspg2	UTSW	4	137511069	missense	probably damaging	1.00
R9534:Hspg2	UTSW	4	137540761	missense	probably benign
R9656:Hspg2	UTSW	4	137551885	missense	probably benign
R9664:Hspg2	UTSW	4	137539576	missense	probably benign	0.03
R9695:Hspg2	UTSW	4	137538390	missense	probably damaging	1.00
R9741:Hspg2	UTSW	4	137512651	missense	probably damaging	1.00
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
X0028:Hspg2	UTSW	4	137550391	missense	probably benign
Z1177:Hspg2	UTSW	4	137550467	missense	probably damaging	1.00
Z1177:Hspg2	UTSW	4	137564518	missense	probably damaging	0.99
Z1177:Hspg2	UTSW	4	137568373	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- GACTGTGCCATTTGTAGGCTACCC -3'
(R):5'- ATCCATTCCCTCTAGCAGGCTGAC -3'

Sequencing Primer
(F):5'- CTGACAGAGAAAGTCCTTGGCTC -3'
(R):5'- ACCCTGGGACGGTGTTAC -3'

Posted On

2013-11-07