Incidental Mutation 'R0930:Adamts18'
ID80771
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
SynonymsE130314N14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location113697126-113848738 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 113705396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000093113] [ENSMUST00000212665] [ENSMUST00000212665]
Predicted Effect probably null
Transcript: ENSMUST00000093113
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093113
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 intron probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5587:Adamts18 UTSW 8 113775360 nonsense probably null
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 113773077 missense probably damaging 1.00
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6006:Adamts18 UTSW 8 113706974 missense probably damaging 1.00
R6608:Adamts18 UTSW 8 113775279 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
R7411:Adamts18 UTSW 8 113777730 missense probably damaging 0.99
R7685:Adamts18 UTSW 8 113713223 missense probably damaging 1.00
R7860:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
R7943:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 113743168 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCAAGTCCTTTGGTTGCAGGCTTC -3'
(R):5'- GTCTTTGCCACTCCAGTACAAACCC -3'

Sequencing Primer
(F):5'- AGGCTTCTTCCAGTTCCAGG -3'
(R):5'- GAGTGAGTAAACCAGTGACCTCATC -3'
Posted On2013-11-07