Incidental Mutation 'R0930:Sdk2'
ID80796
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113838445 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1102 (I1102T)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: I1102T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: I1102T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7980:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAAGCCACAGGTAAAGAATTGTCG -3'
(R):5'- TGATCGCAGCAAGTTGGACAGG -3'

Sequencing Primer
(F):5'- CGATATTTGACTAGTGACCTTTGAG -3'
(R):5'- AACTCGGCAATGAGCCTG -3'
Posted On2013-11-07