Incidental Mutation 'R0930:Exosc4'
ID80816
Institutional Source Beutler Lab
Gene Symbol Exosc4
Ensembl Gene ENSMUSG00000034259
Gene Nameexosome component 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76327397-76330677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76327534 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 14 (I14M)
Ref Sequence ENSEMBL: ENSMUSP00000155254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000165279] [ENSMUST00000169378] [ENSMUST00000170121] [ENSMUST00000172281] [ENSMUST00000230512]
Predicted Effect probably benign
Transcript: ENSMUST00000023221
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059045
AA Change: I14M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259
AA Change: I14M

DomainStartEndE-ValueType
Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164680
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165279
SMART Domains Protein: ENSMUSP00000127955
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 53 8.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168948
SMART Domains Protein: ENSMUSP00000126326
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
Pfam:Gaa1 1 129 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172281
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230512
AA Change: I14M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230818
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Exosc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Exosc4 APN 15 76329636 missense probably damaging 1.00
R0499:Exosc4 UTSW 15 76329566 missense probably benign 0.01
R0622:Exosc4 UTSW 15 76327536 missense probably damaging 1.00
R0718:Exosc4 UTSW 15 76329489 missense probably benign 0.01
R0733:Exosc4 UTSW 15 76329416 missense probably benign
R4881:Exosc4 UTSW 15 76329570 missense probably damaging 1.00
R6560:Exosc4 UTSW 15 76327613 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGACCGGAAAGCGACTAGGCTAC -3'
(R):5'- ACGTTGGGACAACCTGTGTGAG -3'

Sequencing Primer
(F):5'- GCGACTAGGCTACCGGAAG -3'
(R):5'- acctgtgtgagatgctttctg -3'
Posted On2013-11-07