Incidental Mutation 'R0930:Ccdc191'
ID 80820
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R0930 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 43710172-43784677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43751618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 316 (G316V)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122014] [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122014
SMART Domains Protein: ENSMUSP00000112569
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: G258V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: G258V

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: G316V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: G316V

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G T 17: 84,990,705 (GRCm39) V16L probably benign Het
Adamts18 A T 8: 114,432,028 (GRCm39) probably null Het
Agpat4 A T 17: 12,417,723 (GRCm39) E88V probably damaging Het
Ahcyl2 A C 6: 29,870,627 (GRCm39) probably null Het
Ankrd2 T A 19: 42,032,292 (GRCm39) probably null Het
Anxa6 A T 11: 54,885,214 (GRCm39) probably null Het
Bpi A G 2: 158,103,346 (GRCm39) I114V possibly damaging Het
Cacna1c A T 6: 118,652,857 (GRCm39) I772N probably damaging Het
Cacna2d1 A G 5: 16,570,860 (GRCm39) N1045D possibly damaging Het
Caprin2 T C 6: 148,785,009 (GRCm39) probably null Het
Cars1 T A 7: 143,124,307 (GRCm39) H373L probably damaging Het
Cd244a T A 1: 171,404,801 (GRCm39) probably null Het
Ces1a C T 8: 93,749,044 (GRCm39) D456N probably benign Het
Cul3 A T 1: 80,267,835 (GRCm39) M102K probably damaging Het
Dact1 A G 12: 71,365,234 (GRCm39) R672G probably damaging Het
Dapk1 T C 13: 60,905,262 (GRCm39) F991L probably benign Het
Dlg5 G A 14: 24,185,645 (GRCm39) P1920L probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Exosc4 A G 15: 76,211,734 (GRCm39) I14M probably benign Het
Ezr G A 17: 7,021,398 (GRCm39) R180* probably null Het
Fcgbpl1 A T 7: 27,839,555 (GRCm39) Y456F probably damaging Het
Fyb1 A T 15: 6,668,309 (GRCm39) I501F probably damaging Het
Hdac5 G T 11: 102,095,472 (GRCm39) P383Q probably benign Het
Hmx3 A T 7: 131,144,813 (GRCm39) H41L probably benign Het
Krt36 A G 11: 99,994,225 (GRCm39) F284S probably damaging Het
L1td1 A G 4: 98,625,862 (GRCm39) N686D probably damaging Het
Lsamp G A 16: 41,709,327 (GRCm39) G86S probably benign Het
Myh8 A G 11: 67,196,824 (GRCm39) E1819G possibly damaging Het
Myo7a A T 7: 97,747,463 (GRCm39) I129N probably damaging Het
Nckap1 A T 2: 80,384,593 (GRCm39) C114S probably benign Het
Nphp4 T G 4: 152,622,512 (GRCm39) L599R probably benign Het
Nrcam A G 12: 44,596,667 (GRCm39) I301V probably benign Het
Or6b2b A G 1: 92,419,127 (GRCm39) S117P possibly damaging Het
Os9 C T 10: 126,932,924 (GRCm39) R547Q probably damaging Het
Oxtr A T 6: 112,466,598 (GRCm39) probably null Het
Pgm2 A T 5: 64,269,490 (GRCm39) I526F possibly damaging Het
Plekho2 T C 9: 65,464,105 (GRCm39) D248G possibly damaging Het
Rab43 A T 6: 87,769,752 (GRCm39) Y151* probably null Het
Rbm19 A G 5: 120,264,269 (GRCm39) E343G probably benign Het
Rel A T 11: 23,692,439 (GRCm39) D531E probably benign Het
Rfx4 T A 10: 84,704,291 (GRCm39) V262E probably damaging Het
Ryr3 A G 2: 112,672,178 (GRCm39) L1431P probably damaging Het
Sdk2 A G 11: 113,729,271 (GRCm39) I1102T probably benign Het
Sema3d A C 5: 12,513,183 (GRCm39) D51A possibly damaging Het
Sh2d4a T A 8: 68,787,775 (GRCm39) F294I probably damaging Het
Slc3a1 A G 17: 85,367,171 (GRCm39) T453A probably benign Het
Sod1 A G 16: 90,022,071 (GRCm39) D93G probably benign Het
Sptan1 A G 2: 29,906,040 (GRCm39) N1662S probably damaging Het
Stxbp4 A C 11: 90,512,526 (GRCm39) M1R probably null Het
Tbc1d7 A T 13: 43,318,812 (GRCm39) Y108* probably null Het
Ticam1 A T 17: 56,577,226 (GRCm39) V623D unknown Het
Ticam1 A G 17: 56,578,687 (GRCm39) L136P probably damaging Het
Tjap1 A C 17: 46,569,455 (GRCm39) W512G possibly damaging Het
Unc80 A T 1: 66,549,800 (GRCm39) Q686L possibly damaging Het
Wdr45b A T 11: 121,221,040 (GRCm39) F213I probably damaging Het
Xdh A C 17: 74,230,077 (GRCm39) W285G probably benign Het
Zfp646 C T 7: 127,482,982 (GRCm39) Q1500* probably null Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43,779,663 (GRCm39) missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43,780,385 (GRCm39) missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43,777,257 (GRCm39) missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43,780,462 (GRCm39) missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43,742,164 (GRCm39) intron probably benign
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0346:Ccdc191 UTSW 16 43,759,315 (GRCm39) missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43,751,704 (GRCm39) nonsense probably null
R0907:Ccdc191 UTSW 16 43,735,901 (GRCm39) missense probably benign 0.03
R1761:Ccdc191 UTSW 16 43,763,873 (GRCm39) missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43,728,998 (GRCm39) missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43,751,561 (GRCm39) missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43,764,330 (GRCm39) splice site probably null
R3104:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43,751,646 (GRCm39) missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43,759,536 (GRCm39) splice site probably benign
R4788:Ccdc191 UTSW 16 43,777,185 (GRCm39) missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43,763,868 (GRCm39) missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43,728,976 (GRCm39) missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43,735,848 (GRCm39) missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43,767,820 (GRCm39) nonsense probably null
R7543:Ccdc191 UTSW 16 43,718,572 (GRCm39) nonsense probably null
R7843:Ccdc191 UTSW 16 43,779,699 (GRCm39) missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43,735,968 (GRCm39) critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43,710,262 (GRCm39) start gained probably benign
R8984:Ccdc191 UTSW 16 43,710,581 (GRCm39) intron probably benign
R8987:Ccdc191 UTSW 16 43,751,710 (GRCm39) missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43,718,512 (GRCm39) missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43,725,831 (GRCm39) missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43,764,041 (GRCm39) nonsense probably null
R9448:Ccdc191 UTSW 16 43,759,338 (GRCm39) missense
R9507:Ccdc191 UTSW 16 43,764,192 (GRCm39) missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43,762,170 (GRCm39) missense
Z1177:Ccdc191 UTSW 16 43,759,485 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCAGTTTAACATGGGACCAGTGCC -3'
(R):5'- GGAAGCTGCCCTTGATATGTACACC -3'

Sequencing Primer
(F):5'- GAAGCTATGAGTACCTCTGATGCC -3'
(R):5'- TGCCCTTGATATGTACACCAGAAG -3'
Posted On 2013-11-07