Mutagenetix > Incidental Mutation

Incidental Mutation 'R0883:Muc5ac'

80825

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

039050-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141796265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 582 (T582A)

Ref Sequence

ENSEMBL: ENSMUSP00000131681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041924
AA Change: T582A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: T582A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155534
AA Change: T583A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: T583A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163321
AA Change: T582A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: T582A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Meta Mutation Damage Score

0.1870

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

98% (148/151)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 150 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
4930595M18Rik	G	T	X: 81,420,931	T390N	possibly damaging	Het
Abca13	C	T	11: 9,291,238	Q1034*	probably null	Het
Adgra3	T	C	5: 49,960,723	H1161R	probably damaging	Het
AF529169	T	C	9: 89,602,417	H309R	probably benign	Het
Aff1	T	C	5: 103,826,138		probably benign	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Ankrd12	A	G	17: 65,985,132	V1102A	probably benign	Het
Ankrd54	A	T	15: 79,062,731	C23S	probably damaging	Het
Anxa10	C	T	8: 62,077,967	V70I	probably benign	Het
Asap3	T	C	4: 136,234,325		probably benign	Het
Asb13	T	C	13: 3,645,052		probably null	Het
Atp6v1a	A	T	16: 44,101,692		probably benign	Het
Atp8b1	T	G	18: 64,564,541	I411L	probably benign	Het
Baiap3	T	A	17: 25,249,101	N313I	probably damaging	Het
Bok	T	C	1: 93,686,487	I14T	probably benign	Het
Bri3bp	T	A	5: 125,441,744		probably null	Het
C2cd2l	A	G	9: 44,316,202	L186P	probably damaging	Het
Cadm2	A	T	16: 66,882,814	C44S	probably damaging	Het
Capn11	T	C	17: 45,638,881		probably benign	Het
Carm1	T	A	9: 21,569,591		probably benign	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Ccdc27	T	C	4: 154,036,484	E285G	unknown	Het
Cct3	T	A	3: 88,313,557	D298E	probably damaging	Het
Cd59b	T	A	2: 104,080,986		probably benign	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Celsr3	T	A	9: 108,842,633	I2470N	probably damaging	Het
Cfap100	G	A	6: 90,415,906		probably benign	Het
Cfap45	A	T	1: 172,532,189	R98S	possibly damaging	Het
Cfap54	T	A	10: 92,870,669	H2757L	unknown	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Cntn4	A	T	6: 106,667,540		probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Daam2	A	T	17: 49,498,883		probably benign	Het
Ddias	A	T	7: 92,859,337	W457R	probably benign	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Dhx57	T	C	17: 80,270,371	T570A	probably damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Dtymk	C	T	1: 93,801,788	V14M	possibly damaging	Het
Dync2li1	G	A	17: 84,649,271	M286I	probably benign	Het
Eea1	G	A	10: 96,021,667	D664N	possibly damaging	Het
Esp6	G	T	17: 40,565,396	V112L	probably benign	Het
Fam83h	G	T	15: 76,006,169	Q127K	probably damaging	Het
Gabbr2	G	A	4: 46,677,474	T802I	probably benign	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm4907	A	T	X: 23,907,051	I264F	probably benign	Het
Gm5941	G	A	X: 92,490,211	A62T	possibly damaging	Het
Gng2	G	T	14: 19,891,295	D26E	probably benign	Het
Gpr33	A	G	12: 52,023,635	V207A	probably benign	Het
Gstm3	T	A	3: 107,966,270		probably benign	Het
Havcr1	T	C	11: 46,752,432	C60R	probably damaging	Het
Hspg2	T	C	4: 137,541,440	S2157P	probably benign	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Igsf8	C	A	1: 172,316,259	A56D	possibly damaging	Het
Kat6a	G	T	8: 22,862,214	A5S	probably damaging	Het
Kctd16	A	G	18: 40,530,775	E319G	probably damaging	Het
Kmo	T	C	1: 175,647,140	V157A	possibly damaging	Het
Lrp5	T	A	19: 3,605,308	I1071F	probably damaging	Het
Lrrc17	A	G	5: 21,561,278	T253A	probably benign	Het
Mast2	T	A	4: 116,311,767	H769L	probably damaging	Het
Mast4	T	C	13: 102,853,900	K50E	probably damaging	Het
Mbd5	A	G	2: 49,256,689	T304A	possibly damaging	Het
Mbp	T	C	18: 82,572,870	S73P	probably damaging	Het
Mc5r	T	A	18: 68,339,092	V174E	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mlh3	C	G	12: 85,235,714	A1382P	possibly damaging	Het
Mpdz	T	C	4: 81,359,991		probably benign	Het
Mum1l1	T	A	X: 139,235,695	D327E	probably damaging	Het
Nalcn	A	G	14: 123,464,740	F453S	probably damaging	Het
Nrap	T	A	19: 56,345,474	M902L	probably damaging	Het
Nup85	C	T	11: 115,568,370	R100*	probably null	Het
Nxf1	T	G	19: 8,764,591	N296K	probably damaging	Het
Ogg1	A	G	6: 113,328,420	T65A	probably damaging	Het
Ogt	A	G	X: 101,644,199		probably benign	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr504	T	A	7: 108,565,276	N173I	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Ovol2	T	C	2: 144,331,790	D24G	probably damaging	Het
Pabpc1	A	G	15: 36,599,054		probably benign	Het
Pak6	T	C	2: 118,693,687	L441P	probably damaging	Het
Pappa	T	A	4: 65,189,315	C654*	probably null	Het
Paqr6	T	A	3: 88,365,991	S97T	probably damaging	Het
Parp14	T	C	16: 35,858,518	N360S	probably benign	Het
Pclo	G	T	5: 14,677,859	G2244*	probably null	Het
Pdzrn3	A	T	6: 101,155,942		probably null	Het
Pes1	T	C	11: 3,975,557	M220T	probably damaging	Het
Phip	A	T	9: 82,876,221	V1473E	probably benign	Het
Pkd2l2	T	A	18: 34,430,268		probably null	Het
Plch1	T	C	3: 63,753,256	D302G	probably damaging	Het
Plekhh2	A	G	17: 84,618,031	T1419A	probably benign	Het
Ppara	A	T	15: 85,798,171	E356V	probably damaging	Het
Ppp1r37	G	A	7: 19,532,177	P555S	probably benign	Het
Ppp6r1	T	C	7: 4,639,710	E545G	possibly damaging	Het
Proser3	G	A	7: 30,540,699	H327Y	probably damaging	Het
Prss43	T	A	9: 110,829,508	I292N	probably damaging	Het
Pygl	G	C	12: 70,206,404	N271K	probably damaging	Het
Rassf7	T	A	7: 141,216,990		probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Rspo1	T	A	4: 124,991,432		probably null	Het
Sav1	A	C	12: 69,966,205	L366V	probably benign	Het
Sema3b	T	G	9: 107,604,156	T52P	possibly damaging	Het
Senp6	A	G	9: 80,116,559	D40G	probably damaging	Het
Sh3pxd2a	A	G	19: 47,268,207	S719P	probably damaging	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Slc34a3	G	T	2: 25,231,233	D307E	probably benign	Het
Slc35b3	T	C	13: 38,937,275	I330V	probably benign	Het
Slc4a10	G	A	2: 62,243,398	C268Y	probably benign	Het
Slco6d1	A	G	1: 98,421,399	E65G	probably benign	Het
Slit2	A	G	5: 48,245,573		probably benign	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Snap47	A	G	11: 59,438,500		probably benign	Het
Snrnp25	G	A	11: 32,206,960	V15I	probably damaging	Het
Spns2	T	C	11: 72,454,397	Y449C	probably damaging	Het
Stab2	T	A	10: 86,924,450		probably benign	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tbc1d2	T	A	4: 46,609,003	K745*	probably null	Het
Tctn1	T	C	5: 122,264,144	T76A	probably damaging	Het
Tfpi	T	C	2: 84,443,320		probably benign	Het
Timm44	A	T	8: 4,266,592	H317Q	probably benign	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Tnpo3	A	T	6: 29,554,993		probably benign	Het
Top3b	T	C	16: 16,879,437		probably benign	Het
Trak1	T	A	9: 121,453,285	M410K	possibly damaging	Het
Trpm3	C	A	19: 22,978,654	P1160Q	probably damaging	Het
Tyk2	T	A	9: 21,111,137	T799S	possibly damaging	Het
Ubfd1	G	A	7: 122,067,491		probably benign	Het
Unc13a	G	A	8: 71,642,173	R1272*	probably null	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Urb2	C	T	8: 124,030,970	Q1139*	probably null	Het
Vmn2r66	A	T	7: 85,007,862	S112T	probably benign	Het
Vmn2r71	A	T	7: 85,623,634	D552V	probably benign	Het
Vmn2r76	A	G	7: 86,228,696	Y498H	probably benign	Het
Vmn2r84	A	C	10: 130,391,115	W285G	probably damaging	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Yaf2	T	C	15: 93,285,536	K131R	probably damaging	Het
Zfp141	A	T	7: 42,476,056	Y331N	possibly damaging	Het
Zfp324	G	T	7: 12,971,024	C380F	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9049:Muc5ac	UTSW	7	141808975	missense	unknown
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9287:Muc5ac	UTSW	7	141807889	missense	probably damaging	0.99
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9454:Muc5ac	UTSW	7	141808694	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ATGCAAACATCTGTGCGTCTGAAAC -3'
(R):5'- TCAGGGTAGATAGCTGGACACCAAG -3'

Sequencing Primer
(F):5'- GAGCTCACATGAGGCTTCAA -3'
(R):5'- CAAGCCAGGTCAGAGTTTGC -3'

Posted On

2013-11-07