Incidental Mutation 'R0930:Agpat4'
ID80826
Institutional Source Beutler Lab
Gene Symbol Agpat4
Ensembl Gene ENSMUSG00000023827
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12118704-12219645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12198836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 88 (E88V)
Ref Sequence ENSEMBL: ENSMUSP00000127477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024594] [ENSMUST00000164143] [ENSMUST00000167792] [ENSMUST00000170858]
Predicted Effect probably damaging
Transcript: ENSMUST00000024594
AA Change: E88V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024594
Gene: ENSMUSG00000023827
AA Change: E88V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
PlsC 90 212 6.58e-24 SMART
Pfam:Acyltransf_C 241 314 8.8e-29 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164143
AA Change: E88V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128085
Gene: ENSMUSG00000023827
AA Change: E88V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
PlsC 90 192 1.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167792
AA Change: E88V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127477
Gene: ENSMUSG00000023827
AA Change: E88V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
PlsC 90 166 1.14e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170858
SMART Domains Protein: ENSMUSP00000127417
Gene: ENSMUSG00000023827

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit changes in brain phospholipid content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Ticam1 A T 17: 56,270,226 V623D unknown Het
Ticam1 A G 17: 56,271,687 L136P probably damaging Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Agpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1217:Agpat4 UTSW 17 12210316 missense probably damaging 1.00
R1732:Agpat4 UTSW 17 12216728 missense probably benign 0.00
R2081:Agpat4 UTSW 17 12151884 missense possibly damaging 0.58
R4610:Agpat4 UTSW 17 12210377 splice site probably null
R4766:Agpat4 UTSW 17 12151750 unclassified probably benign
R5091:Agpat4 UTSW 17 12198812 missense probably benign
R5817:Agpat4 UTSW 17 12215210 intron probably benign
R7315:Agpat4 UTSW 17 12210298 missense probably damaging 1.00
R7762:Agpat4 UTSW 17 12210322 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGACACAGATGTGGGTGAACTCGAC -3'
(R):5'- ACGGCAGACTCTCTGGGAGGGATAG -3'

Sequencing Primer
(F):5'- TCTGGGCTGAAATACTCTGCAAC -3'
(R):5'- ATAGGGGGTGGAGCGTG -3'
Posted On2013-11-07