Incidental Mutation 'R0930:Ticam1'
ID80836
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0930 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56271687 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 136 (L136P)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably damaging
Transcript: ENSMUST00000058136
AA Change: L136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: L136P

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Abcg8 G T 17: 84,683,277 V16L probably benign Het
Adamts18 A T 8: 113,705,396 probably null Het
Agpat4 A T 17: 12,198,836 E88V probably damaging Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ankrd2 T A 19: 42,043,853 probably null Het
Anxa6 A T 11: 54,994,388 probably null Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Caprin2 T C 6: 148,883,511 probably null Het
Cars T A 7: 143,570,570 H373L probably damaging Het
Ccdc191 G T 16: 43,931,255 G316V probably damaging Het
Cd244 T A 1: 171,577,233 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Dact1 A G 12: 71,318,460 R672G probably damaging Het
Dapk1 T C 13: 60,757,448 F991L probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Exosc4 A G 15: 76,327,534 I14M probably benign Het
Ezr G A 17: 6,753,999 R180* probably null Het
Fyb A T 15: 6,638,828 I501F probably damaging Het
Hdac5 G T 11: 102,204,646 P383Q probably benign Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Krt36 A G 11: 100,103,399 F284S probably damaging Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lsamp G A 16: 41,888,964 G86S probably benign Het
Myh8 A G 11: 67,305,998 E1819G possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nphp4 T G 4: 152,538,055 L599R probably benign Het
Nrcam A G 12: 44,549,884 I301V probably benign Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Os9 C T 10: 127,097,055 R547Q probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Plekho2 T C 9: 65,556,823 D248G possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sdk2 A G 11: 113,838,445 I1102T probably benign Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Slc3a1 A G 17: 85,059,743 T453A probably benign Het
Sod1 A G 16: 90,225,183 D93G probably benign Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Stxbp4 A C 11: 90,621,700 M1R probably null Het
Tbc1d7 A T 13: 43,165,336 Y108* probably null Het
Tjap1 A C 17: 46,258,529 W512G possibly damaging Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Wdr45b A T 11: 121,330,214 F213I probably damaging Het
Xdh A C 17: 73,923,082 W285G probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R7968:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATGTCCCCAACTCCAGTCTGGTG -3'
(R):5'- TGTTCAGGCAGCCAGGAGTCAAAG -3'

Sequencing Primer
(F):5'- TGTGTCAATGGGACGAGGC -3'
(R):5'- GGAGTCAAAGCTTCTCCATGC -3'
Posted On2013-11-07