Mutagenetix > Incidental Mutations

Incidental Mutation 'R0930:Xdh'

80838

Institutional Source

Beutler Lab

Gene Symbol

Xdh

Ensembl Gene

ENSMUSG00000024066

Gene Name

xanthine dehydrogenase

Synonyms

xanthine oxidase, XO, Xor, Xox1, Xox-1

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.439) question?

Stock #

R0930 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73883908-73950182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 73923082 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Glycine at position 285 (W285G)

Ref Sequence

ENSEMBL: ENSMUSP00000024866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024866]

Predicted Effect

probably benign
Transcript: ENSMUST00000024866
AA Change: W285G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: W285G

Domain	Start	End	E-Value	Type
Pfam:Fer2	11	81	5e-12	PFAM
Pfam:Fer2_2	90	163	4.1e-31	PFAM
low complexity region	169	182	N/A	INTRINSIC
Pfam:FAD_binding_5	234	414	4.9e-47	PFAM
CO_deh_flav_C	421	525	1.16e-24	SMART
Ald_Xan_dh_C	590	696	1.23e-46	SMART
Pfam:Ald_Xan_dh_C2	704	1239	1e-200	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	T	7: 28,140,130	Y456F	probably damaging	Het
Abcg8	G	T	17: 84,683,277	V16L	probably benign	Het
Adamts18	A	T	8: 113,705,396		probably null	Het
Agpat4	A	T	17: 12,198,836	E88V	probably damaging	Het
Ahcyl2	A	C	6: 29,870,628		probably null	Het
Ankrd2	T	A	19: 42,043,853		probably null	Het
Anxa6	A	T	11: 54,994,388		probably null	Het
Bpi	A	G	2: 158,261,426	I114V	possibly damaging	Het
Cacna1c	A	T	6: 118,675,896	I772N	probably damaging	Het
Cacna2d1	A	G	5: 16,365,862	N1045D	possibly damaging	Het
Caprin2	T	C	6: 148,883,511		probably null	Het
Cars	T	A	7: 143,570,570	H373L	probably damaging	Het
Ccdc191	G	T	16: 43,931,255	G316V	probably damaging	Het
Cd244	T	A	1: 171,577,233		probably null	Het
Ces1a	C	T	8: 93,022,416	D456N	probably benign	Het
Cul3	A	T	1: 80,290,118	M102K	probably damaging	Het
Dact1	A	G	12: 71,318,460	R672G	probably damaging	Het
Dapk1	T	C	13: 60,757,448	F991L	probably benign	Het
Dlg5	G	A	14: 24,135,577	P1920L	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Exosc4	A	G	15: 76,327,534	I14M	probably benign	Het
Ezr	G	A	17: 6,753,999	R180*	probably null	Het
Fyb	A	T	15: 6,638,828	I501F	probably damaging	Het
Hdac5	G	T	11: 102,204,646	P383Q	probably benign	Het
Hmx3	A	T	7: 131,543,084	H41L	probably benign	Het
Krt36	A	G	11: 100,103,399	F284S	probably damaging	Het
L1td1	A	G	4: 98,737,625	N686D	probably damaging	Het
Lsamp	G	A	16: 41,888,964	G86S	probably benign	Het
Myh8	A	G	11: 67,305,998	E1819G	possibly damaging	Het
Myo7a	A	T	7: 98,098,256	I129N	probably damaging	Het
Nckap1	A	T	2: 80,554,249	C114S	probably benign	Het
Nphp4	T	G	4: 152,538,055	L599R	probably benign	Het
Nrcam	A	G	12: 44,549,884	I301V	probably benign	Het
Olfr1415	A	G	1: 92,491,405	S117P	possibly damaging	Het
Os9	C	T	10: 127,097,055	R547Q	probably damaging	Het
Oxtr	A	T	6: 112,489,637		probably null	Het
Pgm1	A	T	5: 64,112,147	I526F	possibly damaging	Het
Plekho2	T	C	9: 65,556,823	D248G	possibly damaging	Het
Rab43	A	T	6: 87,792,770	Y151*	probably null	Het
Rbm19	A	G	5: 120,126,204	E343G	probably benign	Het
Rel	A	T	11: 23,742,439	D531E	probably benign	Het
Rfx4	T	A	10: 84,868,427	V262E	probably damaging	Het
Ryr3	A	G	2: 112,841,833	L1431P	probably damaging	Het
Sdk2	A	G	11: 113,838,445	I1102T	probably benign	Het
Sema3d	A	C	5: 12,463,216	D51A	possibly damaging	Het
Sh2d4a	T	A	8: 68,335,123	F294I	probably damaging	Het
Slc3a1	A	G	17: 85,059,743	T453A	probably benign	Het
Sod1	A	G	16: 90,225,183	D93G	probably benign	Het
Sptan1	A	G	2: 30,016,028	N1662S	probably damaging	Het
Stxbp4	A	C	11: 90,621,700	M1R	probably null	Het
Tbc1d7	A	T	13: 43,165,336	Y108*	probably null	Het
Ticam1	A	T	17: 56,270,226	V623D	unknown	Het
Ticam1	A	G	17: 56,271,687	L136P	probably damaging	Het
Tjap1	A	C	17: 46,258,529	W512G	possibly damaging	Het
Unc80	A	T	1: 66,510,641	Q686L	possibly damaging	Het
Wdr45b	A	T	11: 121,330,214	F213I	probably damaging	Het
Zfp646	C	T	7: 127,883,810	Q1500*	probably null	Het

Other mutations in Xdh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Xdh	APN	17	73923106	missense	possibly damaging	0.58
IGL00556:Xdh	APN	17	73884435	makesense	probably null
IGL01524:Xdh	APN	17	73923137	critical splice acceptor site	probably null
IGL01604:Xdh	APN	17	73909337	missense	probably benign	0.02
IGL01625:Xdh	APN	17	73916786	critical splice donor site	probably null
IGL01778:Xdh	APN	17	73900280	missense	probably benign	0.00
IGL01804:Xdh	APN	17	73892759	missense	probably damaging	1.00
IGL01825:Xdh	APN	17	73891245	missense	probably damaging	1.00
IGL01929:Xdh	APN	17	73934855	missense	probably damaging	1.00
IGL02068:Xdh	APN	17	73913950	missense	probably damaging	1.00
IGL02079:Xdh	APN	17	73891277	missense	probably damaging	1.00
IGL02210:Xdh	APN	17	73943895	missense	probably benign	0.00
IGL02261:Xdh	APN	17	73913965	missense	possibly damaging	0.81
IGL02365:Xdh	APN	17	73943890	missense	probably benign	0.14
IGL02424:Xdh	APN	17	73926570	missense	probably benign	0.00
IGL02491:Xdh	APN	17	73886464	missense	probably damaging	0.99
IGL02525:Xdh	APN	17	73924995	missense	possibly damaging	0.91
IGL02578:Xdh	APN	17	73906246	missense	probably damaging	1.00
IGL02793:Xdh	APN	17	73900581	missense	probably damaging	1.00
IGL02939:Xdh	APN	17	73943845	critical splice donor site	probably null
IGL03327:Xdh	APN	17	73916792	missense	probably benign
IGL03345:Xdh	APN	17	73906032	missense	probably damaging	0.98
IGL03353:Xdh	APN	17	73895786	missense	possibly damaging	0.65
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0033:Xdh	UTSW	17	73907632	missense	probably benign	0.06
R0079:Xdh	UTSW	17	73891218	missense	probably damaging	1.00
R0086:Xdh	UTSW	17	73884438	missense	probably benign
R0319:Xdh	UTSW	17	73906101	splice site	probably benign
R0336:Xdh	UTSW	17	73922463	missense	possibly damaging	0.91
R0389:Xdh	UTSW	17	73898362	missense	probably damaging	1.00
R0684:Xdh	UTSW	17	73943891	missense	probably damaging	0.97
R1073:Xdh	UTSW	17	73939836	missense	probably benign
R1114:Xdh	UTSW	17	73941149	splice site	probably benign
R1201:Xdh	UTSW	17	73918418	missense	probably benign	0.05
R1230:Xdh	UTSW	17	73891256	missense	probably damaging	1.00
R1351:Xdh	UTSW	17	73923078	missense	probably benign	0.02
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1485:Xdh	UTSW	17	73914019	nonsense	probably null
R1548:Xdh	UTSW	17	73913901	missense	probably damaging	0.98
R1637:Xdh	UTSW	17	73900578	missense	probably benign
R1641:Xdh	UTSW	17	73926552	missense	probably benign
R1758:Xdh	UTSW	17	73910209	missense	probably damaging	1.00
R1951:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R1969:Xdh	UTSW	17	73892751	missense	possibly damaging	0.55
R2024:Xdh	UTSW	17	73921305	missense	possibly damaging	0.92
R2080:Xdh	UTSW	17	73909325	missense	probably damaging	1.00
R2157:Xdh	UTSW	17	73922537	missense	probably damaging	1.00
R2300:Xdh	UTSW	17	73891265	missense	probably damaging	1.00
R3783:Xdh	UTSW	17	73893595	splice site	probably benign
R3796:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3797:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3798:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3799:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3819:Xdh	UTSW	17	73906725	missense	probably benign	0.35
R4085:Xdh	UTSW	17	73916879	missense	probably benign	0.35
R4240:Xdh	UTSW	17	73895795	missense	possibly damaging	0.72
R4356:Xdh	UTSW	17	73915690	missense	probably benign	0.01
R4522:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4523:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4524:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4600:Xdh	UTSW	17	73910200	missense	probably benign	0.19
R4617:Xdh	UTSW	17	73918394	missense	probably damaging	0.99
R4756:Xdh	UTSW	17	73886386	missense	probably benign	0.24
R4761:Xdh	UTSW	17	73910267	missense	possibly damaging	0.91
R4815:Xdh	UTSW	17	73906215	missense	probably damaging	1.00
R4850:Xdh	UTSW	17	73898335	missense	probably damaging	1.00
R4896:Xdh	UTSW	17	73910243	missense	probably damaging	0.96
R4897:Xdh	UTSW	17	73900708	missense	probably benign
R4923:Xdh	UTSW	17	73924936	missense	possibly damaging	0.72
R4977:Xdh	UTSW	17	73898970	missense	probably benign	0.05
R5030:Xdh	UTSW	17	73891293	missense	probably damaging	1.00
R5185:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R5347:Xdh	UTSW	17	73925032	missense	probably benign
R5556:Xdh	UTSW	17	73897764	missense	probably benign	0.21
R5566:Xdh	UTSW	17	73893622	missense	probably damaging	1.00
R5568:Xdh	UTSW	17	73943885	missense	possibly damaging	0.90
R5635:Xdh	UTSW	17	73913875	missense	possibly damaging	0.92
R5662:Xdh	UTSW	17	73941115	missense	probably damaging	0.99
R5955:Xdh	UTSW	17	73898320	missense	probably damaging	1.00
R6058:Xdh	UTSW	17	73906269	missense	probably damaging	1.00
R6061:Xdh	UTSW	17	73921347	missense	probably damaging	1.00
R6412:Xdh	UTSW	17	73935907	missense	probably benign	0.09
R6526:Xdh	UTSW	17	73900551	missense	probably damaging	0.97
R6558:Xdh	UTSW	17	73893713	missense	possibly damaging	0.95
R6843:Xdh	UTSW	17	73923130	missense	probably damaging	1.00
R6932:Xdh	UTSW	17	73922562	missense	probably damaging	0.99
R7028:Xdh	UTSW	17	73943873	missense	probably damaging	0.99
R7418:Xdh	UTSW	17	73913965	missense	possibly damaging	0.81
R7503:Xdh	UTSW	17	73926210	missense	probably damaging	1.00
R7653:Xdh	UTSW	17	73897045	missense	probably benign	0.10
R7763:Xdh	UTSW	17	73934834	missense	possibly damaging	0.69
R7768:Xdh	UTSW	17	73939836	missense	probably benign
R7904:Xdh	UTSW	17	73922472	missense	probably benign	0.09
R8010:Xdh	UTSW	17	73909317	nonsense	probably null
R8067:Xdh	UTSW	17	73900657	missense	probably benign	0.01
R8238:Xdh	UTSW	17	73886417	missense	probably benign
R8253:Xdh	UTSW	17	73918382	missense	possibly damaging	0.94
R8346:Xdh	UTSW	17	73913943	missense	probably damaging	1.00
R8350:Xdh	UTSW	17	73934842	missense	probably damaging	1.00
R8381:Xdh	UTSW	17	73912461	missense	probably benign
R8427:Xdh	UTSW	17	73935931	missense	probably damaging	1.00
R8465:Xdh	UTSW	17	73899012	nonsense	probably null
R8478:Xdh	UTSW	17	73906058	missense	probably benign	0.00
R8680:Xdh	UTSW	17	73922505	missense	probably benign
X0019:Xdh	UTSW	17	73918454	missense	probably damaging	1.00
Z1088:Xdh	UTSW	17	73886428	missense	probably benign
Z1176:Xdh	UTSW	17	73923042	critical splice donor site	probably null
Z1177:Xdh	UTSW	17	73897695	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCTCGACATGAGCTGGGAC -3'
(R):5'- CGCCATACTCAGTGTGATGCTCAAC -3'

Sequencing Primer
(F):5'- GTGATTCAATGCGCCATCAG -3'
(R):5'- GTGTGATGCTCAACAAGCC -3'

Posted On

2013-11-07