Incidental Mutation 'R0931:Gss'
ID80859
Institutional Source Beutler Lab
Gene Symbol Gss
Ensembl Gene ENSMUSG00000027610
Gene Nameglutathione synthetase
SynonymsGS-A/GS-B
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155563181-155592810 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 155567689 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000130881]
Predicted Effect probably benign
Transcript: ENSMUST00000029135
SMART Domains Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 1.9e-96 PFAM
Pfam:AMP-binding_C 583 661 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065973
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079691
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130881
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153975
Predicted Effect probably benign
Transcript: ENSMUST00000175993
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Gss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Gss APN 2 155581951 missense probably damaging 1.00
IGL01737:Gss APN 2 155567806 missense probably damaging 1.00
IGL01783:Gss APN 2 155571559 missense probably damaging 1.00
IGL02329:Gss APN 2 155567853 missense probably benign 0.01
IGL02386:Gss APN 2 155573170 missense probably benign 0.01
IGL02948:Gss APN 2 155577621 missense probably damaging 1.00
PIT4515001:Gss UTSW 2 155578341 missense probably damaging 1.00
R0230:Gss UTSW 2 155578406 missense probably damaging 1.00
R0446:Gss UTSW 2 155567745 missense probably benign 0.00
R1396:Gss UTSW 2 155567721 missense probably damaging 0.99
R2896:Gss UTSW 2 155564829 missense probably damaging 1.00
R2986:Gss UTSW 2 155587443 missense probably benign 0.21
R4852:Gss UTSW 2 155564865 missense probably benign 0.06
R5148:Gss UTSW 2 155573109 missense possibly damaging 0.80
R6017:Gss UTSW 2 155587465 missense probably benign
R6574:Gss UTSW 2 155582011 missense probably damaging 1.00
R6868:Gss UTSW 2 155567812 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATCATCACCATTGCTGAGGGAGTTG -3'
(R):5'- TGCCAAGTGTCCAGACATTGCC -3'

Sequencing Primer
(F):5'- gctcttaccttgatgataatggatg -3'
(R):5'- GTGTCCAGACATTGCCATACAG -3'
Posted On2013-11-07