Incidental Mutation 'R0931:Mettl27'
ID80871
Institutional Source Beutler Lab
Gene Symbol Mettl27
Ensembl Gene ENSMUSG00000040557
Gene Namemethyltransferase like 27
SynonymsWbscr27
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134932368-134942637 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 134934431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047196] [ENSMUST00000068617] [ENSMUST00000111218] [ENSMUST00000111219] [ENSMUST00000111221] [ENSMUST00000136246] [ENSMUST00000201847]
Predicted Effect probably benign
Transcript: ENSMUST00000047196
SMART Domains Protein: ENSMUSP00000039080
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 45 217 4.9e-13 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 4.7e-14 PFAM
Pfam:Methyltransf_31 67 215 1.4e-12 PFAM
Pfam:Methyltransf_25 71 162 1.4e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068617
SMART Domains Protein: ENSMUSP00000067814
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Methyltransf_23 46 185 9e-9 PFAM
Pfam:Methyltransf_18 67 164 3.8e-10 PFAM
Pfam:Methyltransf_11 72 148 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111218
SMART Domains Protein: ENSMUSP00000106849
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 46 219 6.2e-14 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 7.2e-15 PFAM
Pfam:Methyltransf_31 67 216 1e-12 PFAM
Pfam:Methyltransf_25 71 162 1.3e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111219
SMART Domains Protein: ENSMUSP00000106850
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 46 219 6.2e-14 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 7.2e-15 PFAM
Pfam:Methyltransf_31 67 216 1e-12 PFAM
Pfam:Methyltransf_25 71 162 1.3e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111221
SMART Domains Protein: ENSMUSP00000106852
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Methyltransf_23 46 185 9e-9 PFAM
Pfam:Methyltransf_18 67 164 3.8e-10 PFAM
Pfam:Methyltransf_11 72 148 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136246
SMART Domains Protein: ENSMUSP00000119451
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 28 116 1.2e-6 PFAM
Pfam:Methyltransf_23 45 123 1.3e-8 PFAM
Pfam:Methyltransf_18 67 127 2.5e-10 PFAM
Pfam:Methyltransf_11 72 127 5.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136815
Predicted Effect probably benign
Transcript: ENSMUST00000201847
SMART Domains Protein: ENSMUSP00000144170
Gene: ENSMUSG00000040557

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 2.3e-9 PFAM
Pfam:Methyltransf_23 45 214 6.5e-11 PFAM
Pfam:MetW 62 165 8.7e-5 PFAM
Pfam:Methyltransf_18 67 169 4e-12 PFAM
Pfam:Methyltransf_31 67 215 1.1e-10 PFAM
Pfam:Methyltransf_25 71 162 1.6e-8 PFAM
Pfam:Methyltransf_12 72 164 2.7e-8 PFAM
Pfam:Methyltransf_11 72 166 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202228
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to ubiE/COQ5 methyltransferase family. The gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.22-q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Mettl27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Mettl27 APN 5 134935880 splice site probably benign
R4039:Mettl27 UTSW 5 134940609 nonsense probably null
R4839:Mettl27 UTSW 5 134934412 missense probably damaging 1.00
R6158:Mettl27 UTSW 5 134940576 missense possibly damaging 0.77
R7226:Mettl27 UTSW 5 134935803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATTACCCATGACTGATGCCAC -3'
(R):5'- GGTGCTTTGCCACAGCAATAAGAAG -3'

Sequencing Primer
(F):5'- ATGACTGATGCCACCTTCTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-11-07