Incidental Mutation 'R0931:Zfp324'
ID80883
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Namezinc finger protein 324
SynonymsD430030K24Rik, ZF5128
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0931 (G1)
Quality Score123
Status Validated
Chromosome7
Chromosomal Location12965838-12974236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12966258 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 15 (I15V)
Ref Sequence ENSEMBL: ENSMUSP00000123956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
Predicted Effect probably benign
Transcript: ENSMUST00000038701
AA Change: I15V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: I15V

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
AA Change: I15V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000128293
AA Change: I15V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500
AA Change: I15V

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186106
Predicted Effect probably benign
Transcript: ENSMUST00000210619
AA Change: I15V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12969435 missense probably benign 0.02
IGL01943:Zfp324 APN 7 12968786 splice site probably benign
IGL02668:Zfp324 APN 7 12970846 missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12971024 missense probably damaging 1.00
R1164:Zfp324 UTSW 7 12971624 missense probably benign 0.02
R1587:Zfp324 UTSW 7 12970643 missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12970229 missense probably benign 0.15
R1982:Zfp324 UTSW 7 12971218 missense probably damaging 1.00
R2333:Zfp324 UTSW 7 12971245 missense possibly damaging 0.93
R3155:Zfp324 UTSW 7 12968890 missense probably damaging 1.00
R4050:Zfp324 UTSW 7 12970867 missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12971306 missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12969373 missense probably benign 0.02
R5970:Zfp324 UTSW 7 12969366 missense probably benign 0.28
R6767:Zfp324 UTSW 7 12970600 missense probably null 0.13
R7007:Zfp324 UTSW 7 12971215 missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12966271 missense probably benign 0.07
R7164:Zfp324 UTSW 7 12968883 missense probably damaging 0.97
R7233:Zfp324 UTSW 7 12970597 nonsense probably null
X0062:Zfp324 UTSW 7 12971389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCTGTTGGCTCATAGGCTGC -3'
(R):5'- AGACCTTACCCACTTGGCTGTCAC -3'

Sequencing Primer
(F):5'- TGCAGCGGAGACCGTTAG -3'
(R):5'- ACTTGGCTGTCACAAGTGAG -3'
Posted On2013-11-07