Incidental Mutation 'R0931:Olfr691'
ID80887
Institutional Source Beutler Lab
Gene Symbol Olfr691
Ensembl Gene ENSMUSG00000043948
Gene Nameolfactory receptor 691
SynonymsGA_x6K02T2PBJ9-7966695-7965727, MOR31-6
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105335509-105342270 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105337529 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 62 (Y62*)
Ref Sequence ENSEMBL: ENSMUSP00000150297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057528] [ENSMUST00000211006] [ENSMUST00000213290] [ENSMUST00000216230]
Predicted Effect probably null
Transcript: ENSMUST00000057528
AA Change: Y62*
SMART Domains Protein: ENSMUSP00000061078
Gene: ENSMUSG00000043948
AA Change: Y62*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1e-112 PFAM
Pfam:7TM_GPCR_Srsx 37 291 1.3e-10 PFAM
Pfam:7tm_1 43 294 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211006
Predicted Effect probably null
Transcript: ENSMUST00000213290
AA Change: Y62*
Predicted Effect probably benign
Transcript: ENSMUST00000216230
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Olfr691
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr691 APN 7 105337143 missense probably damaging 1.00
R0178:Olfr691 UTSW 7 105336922 missense probably benign 0.07
R0344:Olfr691 UTSW 7 105337607 missense probably benign
R1434:Olfr691 UTSW 7 105337261 missense probably benign
R1482:Olfr691 UTSW 7 105337256 missense probably damaging 0.97
R2189:Olfr691 UTSW 7 105337602 missense probably benign
R3836:Olfr691 UTSW 7 105337210 missense probably benign 0.05
R5353:Olfr691 UTSW 7 105337117 missense probably damaging 1.00
R6649:Olfr691 UTSW 7 105337707 missense probably benign 0.00
R6715:Olfr691 UTSW 7 105337332 missense probably damaging 1.00
R7462:Olfr691 UTSW 7 105337500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAATCCTCCCAACTGTGGAC -3'
(R):5'- TGTGCCTCTGCATTGCACTCAAG -3'

Sequencing Primer
(F):5'- CCCAACTGTGGACCATGTTAG -3'
(R):5'- CCTTCAGCAATATAGTGAGCATC -3'
Posted On2013-11-07