Incidental Mutation 'R0931:Rasa2'
ID80895
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96552404 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 610 (M610K)
Ref Sequence ENSEMBL: ENSMUSP00000034984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034984
AA Change: M610K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: M610K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122752
Predicted Effect probably benign
Transcript: ENSMUST00000128346
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185435
Meta Mutation Damage Score 0.3315 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0295:Rasa2 UTSW 9 96545810 splice site probably null
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R3055:Rasa2 UTSW 9 96611473 missense possibly damaging 0.77
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4636:Rasa2 UTSW 9 96544337 missense probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7421:Rasa2 UTSW 9 96611447 missense unknown
R7490:Rasa2 UTSW 9 96566122 missense possibly damaging 0.48
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGGACTTCAAAACCTACTGAGCACC -3'
(R):5'- GACAGCCCTGCATTGATAGAAGGAC -3'

Sequencing Primer
(F):5'- cctgttaagtctgtgcctttc -3'
(R):5'- CGTCCTGAGTCATCCCCAG -3'
Posted On2013-11-07