Incidental Mutation 'R0931:Myrfl'
ID80901
Institutional Source Beutler Lab
Gene Symbol Myrfl
Ensembl Gene ENSMUSG00000034057
Gene Namemyelin regulatory factor-like
SynonymsLOC237558, Gm239
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116776535-116896919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116839449 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 193 (H193L)
Ref Sequence ENSEMBL: ENSMUSP00000037477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048229]
Predicted Effect probably benign
Transcript: ENSMUST00000048229
AA Change: H193L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000037477
Gene: ENSMUSG00000034057
AA Change: H193L

DomainStartEndE-ValueType
Pfam:NDT80_PhoG 252 399 3.4e-29 PFAM
Pfam:Peptidase_S74 446 505 1.6e-18 PFAM
Pfam:MRF_C1 525 560 1.8e-24 PFAM
low complexity region 562 601 N/A INTRINSIC
transmembrane domain 625 647 N/A INTRINSIC
low complexity region 663 691 N/A INTRINSIC
Pfam:MRF_C2 765 903 4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Myrfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Myrfl APN 10 116796106 missense possibly damaging 0.46
IGL00824:Myrfl APN 10 116849359 splice site probably benign
IGL01074:Myrfl APN 10 116779585 missense possibly damaging 0.50
IGL01394:Myrfl APN 10 116822687 missense probably benign 0.01
IGL02283:Myrfl APN 10 116777360 missense probably benign 0.33
IGL02869:Myrfl APN 10 116829004 missense probably damaging 0.98
IGL02878:Myrfl APN 10 116777405 missense possibly damaging 0.70
IGL03112:Myrfl APN 10 116803406 missense probably benign 0.03
F5770:Myrfl UTSW 10 116861530 missense probably damaging 1.00
R0138:Myrfl UTSW 10 116849233 missense probably damaging 0.98
R0402:Myrfl UTSW 10 116828977 missense probably damaging 1.00
R0554:Myrfl UTSW 10 116828973 missense probably damaging 1.00
R0601:Myrfl UTSW 10 116776760 missense probably damaging 1.00
R0790:Myrfl UTSW 10 116817788 missense probably damaging 0.99
R0831:Myrfl UTSW 10 116783209 missense probably benign 0.06
R0945:Myrfl UTSW 10 116803394 splice site probably benign
R1078:Myrfl UTSW 10 116776732 missense possibly damaging 0.94
R1187:Myrfl UTSW 10 116831542 missense probably damaging 1.00
R1329:Myrfl UTSW 10 116777342 critical splice donor site probably null
R1432:Myrfl UTSW 10 116777427 missense probably damaging 1.00
R1762:Myrfl UTSW 10 116798593 missense probably damaging 1.00
R1827:Myrfl UTSW 10 116832947 missense probably damaging 0.99
R1952:Myrfl UTSW 10 116822811 missense probably benign 0.00
R2138:Myrfl UTSW 10 116795538 missense probably benign 0.00
R2317:Myrfl UTSW 10 116839384 missense possibly damaging 0.77
R2930:Myrfl UTSW 10 116817747 missense probably damaging 1.00
R3405:Myrfl UTSW 10 116822865 missense probably damaging 1.00
R4118:Myrfl UTSW 10 116828965 missense probably damaging 1.00
R4700:Myrfl UTSW 10 116777342 critical splice donor site probably null
R5039:Myrfl UTSW 10 116822711 missense probably damaging 1.00
R5097:Myrfl UTSW 10 116817704 missense probably damaging 1.00
R5138:Myrfl UTSW 10 116796058 critical splice donor site probably null
R5211:Myrfl UTSW 10 116798630 missense probably benign 0.00
R5249:Myrfl UTSW 10 116783233 missense probably benign
R5573:Myrfl UTSW 10 116822756 missense probably damaging 0.98
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6091:Myrfl UTSW 10 116849206 missense probably benign
R6315:Myrfl UTSW 10 116822819 missense possibly damaging 0.81
R6812:Myrfl UTSW 10 116832913 missense probably damaging 1.00
R6867:Myrfl UTSW 10 116848282 nonsense probably null
R7019:Myrfl UTSW 10 116781947 critical splice donor site probably null
R7059:Myrfl UTSW 10 116849206 missense probably benign
R7181:Myrfl UTSW 10 116861543 missense probably damaging 0.96
R7471:Myrfl UTSW 10 116861512 missense possibly damaging 0.95
R7574:Myrfl UTSW 10 116831525 nonsense probably null
R7584:Myrfl UTSW 10 116828997 missense probably damaging 1.00
R7667:Myrfl UTSW 10 116839353 missense possibly damaging 0.88
R7801:Myrfl UTSW 10 116848335 missense probably benign
V7582:Myrfl UTSW 10 116861530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCTTTGTCCCAACGATTC -3'
(R):5'- AGGTCAGCAATGCACCTCTTGTC -3'

Sequencing Primer
(F):5'- GGACAGATACCTTCTCAATGGCTC -3'
(R):5'- TTGTCTCCAGCACTCATAGC -3'
Posted On2013-11-07