Mutagenetix > Incidental Mutation

Incidental Mutation 'R0883:Mast4'

80906

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

039050-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Essential gene?

Possibly non essential (E-score: 0.305) question?

Stock #

R0883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102853900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 50 (K50E)

Ref Sequence

ENSEMBL: ENSMUSP00000096808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000164111] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

AlphaFold

Q811L6

Predicted Effect

probably damaging
Transcript: ENSMUST00000099202
AA Change: K50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: K50E

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164111
AA Change: K230E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751
AA Change: K230E

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166336
AA Change: K45E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751
AA Change: K45E

Domain	Start	End	E-Value	Type
Pfam:DUF1908	71	212	1.2e-68	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166726
AA Change: K230E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: K230E

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166867

Predicted Effect

probably damaging
Transcript: ENSMUST00000167058
AA Change: K230E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: K230E

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167462
AA Change: K38E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: K38E

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: K38E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: K38E

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172264
AA Change: K23E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: K23E

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: K62E

Meta Mutation Damage Score

0.0931

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

98% (148/151)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 150 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
4930595M18Rik	G	T	X: 81,420,931	T390N	possibly damaging	Het
Abca13	C	T	11: 9,291,238	Q1034*	probably null	Het
Adgra3	T	C	5: 49,960,723	H1161R	probably damaging	Het
AF529169	T	C	9: 89,602,417	H309R	probably benign	Het
Aff1	T	C	5: 103,826,138		probably benign	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Ankrd12	A	G	17: 65,985,132	V1102A	probably benign	Het
Ankrd54	A	T	15: 79,062,731	C23S	probably damaging	Het
Anxa10	C	T	8: 62,077,967	V70I	probably benign	Het
Asap3	T	C	4: 136,234,325		probably benign	Het
Asb13	T	C	13: 3,645,052		probably null	Het
Atp6v1a	A	T	16: 44,101,692		probably benign	Het
Atp8b1	T	G	18: 64,564,541	I411L	probably benign	Het
Baiap3	T	A	17: 25,249,101	N313I	probably damaging	Het
Bok	T	C	1: 93,686,487	I14T	probably benign	Het
Bri3bp	T	A	5: 125,441,744		probably null	Het
C2cd2l	A	G	9: 44,316,202	L186P	probably damaging	Het
Cadm2	A	T	16: 66,882,814	C44S	probably damaging	Het
Capn11	T	C	17: 45,638,881		probably benign	Het
Carm1	T	A	9: 21,569,591		probably benign	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Ccdc27	T	C	4: 154,036,484	E285G	unknown	Het
Cct3	T	A	3: 88,313,557	D298E	probably damaging	Het
Cd59b	T	A	2: 104,080,986		probably benign	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Celsr3	T	A	9: 108,842,633	I2470N	probably damaging	Het
Cfap100	G	A	6: 90,415,906		probably benign	Het
Cfap45	A	T	1: 172,532,189	R98S	possibly damaging	Het
Cfap54	T	A	10: 92,870,669	H2757L	unknown	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Cntn4	A	T	6: 106,667,540		probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Daam2	A	T	17: 49,498,883		probably benign	Het
Ddias	A	T	7: 92,859,337	W457R	probably benign	Het
Ddr2	C	T	1: 169,994,629	V417I	probably benign	Het
Dhx57	T	C	17: 80,270,371	T570A	probably damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Dtymk	C	T	1: 93,801,788	V14M	possibly damaging	Het
Dync2li1	G	A	17: 84,649,271	M286I	probably benign	Het
Eea1	G	A	10: 96,021,667	D664N	possibly damaging	Het
Esp6	G	T	17: 40,565,396	V112L	probably benign	Het
Fam83h	G	T	15: 76,006,169	Q127K	probably damaging	Het
Gabbr2	G	A	4: 46,677,474	T802I	probably benign	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm4907	A	T	X: 23,907,051	I264F	probably benign	Het
Gm5941	G	A	X: 92,490,211	A62T	possibly damaging	Het
Gng2	G	T	14: 19,891,295	D26E	probably benign	Het
Gpr33	A	G	12: 52,023,635	V207A	probably benign	Het
Gstm3	T	A	3: 107,966,270		probably benign	Het
Havcr1	T	C	11: 46,752,432	C60R	probably damaging	Het
Hspg2	T	C	4: 137,541,440	S2157P	probably benign	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Igsf8	C	A	1: 172,316,259	A56D	possibly damaging	Het
Kat6a	G	T	8: 22,862,214	A5S	probably damaging	Het
Kctd16	A	G	18: 40,530,775	E319G	probably damaging	Het
Kmo	T	C	1: 175,647,140	V157A	possibly damaging	Het
Lrp5	T	A	19: 3,605,308	I1071F	probably damaging	Het
Lrrc17	A	G	5: 21,561,278	T253A	probably benign	Het
Mast2	T	A	4: 116,311,767	H769L	probably damaging	Het
Mbd5	A	G	2: 49,256,689	T304A	possibly damaging	Het
Mbp	T	C	18: 82,572,870	S73P	probably damaging	Het
Mc5r	T	A	18: 68,339,092	V174E	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mlh3	C	G	12: 85,235,714	A1382P	possibly damaging	Het
Mpdz	T	C	4: 81,359,991		probably benign	Het
Muc5ac	A	G	7: 141,796,265	T582A	possibly damaging	Het
Mum1l1	T	A	X: 139,235,695	D327E	probably damaging	Het
Nalcn	A	G	14: 123,464,740	F453S	probably damaging	Het
Nrap	T	A	19: 56,345,474	M902L	probably damaging	Het
Nup85	C	T	11: 115,568,370	R100*	probably null	Het
Nxf1	T	G	19: 8,764,591	N296K	probably damaging	Het
Ogg1	A	G	6: 113,328,420	T65A	probably damaging	Het
Ogt	A	G	X: 101,644,199		probably benign	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr504	T	A	7: 108,565,276	N173I	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Ovol2	T	C	2: 144,331,790	D24G	probably damaging	Het
Pabpc1	A	G	15: 36,599,054		probably benign	Het
Pak6	T	C	2: 118,693,687	L441P	probably damaging	Het
Pappa	T	A	4: 65,189,315	C654*	probably null	Het
Paqr6	T	A	3: 88,365,991	S97T	probably damaging	Het
Parp14	T	C	16: 35,858,518	N360S	probably benign	Het
Pclo	G	T	5: 14,677,859	G2244*	probably null	Het
Pdzrn3	A	T	6: 101,155,942		probably null	Het
Pes1	T	C	11: 3,975,557	M220T	probably damaging	Het
Phip	A	T	9: 82,876,221	V1473E	probably benign	Het
Pkd2l2	T	A	18: 34,430,268		probably null	Het
Plch1	T	C	3: 63,753,256	D302G	probably damaging	Het
Plekhh2	A	G	17: 84,618,031	T1419A	probably benign	Het
Ppara	A	T	15: 85,798,171	E356V	probably damaging	Het
Ppp1r37	G	A	7: 19,532,177	P555S	probably benign	Het
Ppp6r1	T	C	7: 4,639,710	E545G	possibly damaging	Het
Proser3	G	A	7: 30,540,699	H327Y	probably damaging	Het
Prss43	T	A	9: 110,829,508	I292N	probably damaging	Het
Pygl	G	C	12: 70,206,404	N271K	probably damaging	Het
Rassf7	T	A	7: 141,216,990		probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Rspo1	T	A	4: 124,991,432		probably null	Het
Sav1	A	C	12: 69,966,205	L366V	probably benign	Het
Sema3b	T	G	9: 107,604,156	T52P	possibly damaging	Het
Senp6	A	G	9: 80,116,559	D40G	probably damaging	Het
Sh3pxd2a	A	G	19: 47,268,207	S719P	probably damaging	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Slc34a3	G	T	2: 25,231,233	D307E	probably benign	Het
Slc35b3	T	C	13: 38,937,275	I330V	probably benign	Het
Slc4a10	G	A	2: 62,243,398	C268Y	probably benign	Het
Slco6d1	A	G	1: 98,421,399	E65G	probably benign	Het
Slit2	A	G	5: 48,245,573		probably benign	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Snap47	A	G	11: 59,438,500		probably benign	Het
Snrnp25	G	A	11: 32,206,960	V15I	probably damaging	Het
Spns2	T	C	11: 72,454,397	Y449C	probably damaging	Het
Stab2	T	A	10: 86,924,450		probably benign	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tbc1d2	T	A	4: 46,609,003	K745*	probably null	Het
Tctn1	T	C	5: 122,264,144	T76A	probably damaging	Het
Tfpi	T	C	2: 84,443,320		probably benign	Het
Timm44	A	T	8: 4,266,592	H317Q	probably benign	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Tnpo3	A	T	6: 29,554,993		probably benign	Het
Top3b	T	C	16: 16,879,437		probably benign	Het
Trak1	T	A	9: 121,453,285	M410K	possibly damaging	Het
Trpm3	C	A	19: 22,978,654	P1160Q	probably damaging	Het
Tyk2	T	A	9: 21,111,137	T799S	possibly damaging	Het
Ubfd1	G	A	7: 122,067,491		probably benign	Het
Unc13a	G	A	8: 71,642,173	R1272*	probably null	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Urb2	C	T	8: 124,030,970	Q1139*	probably null	Het
Vmn2r66	A	T	7: 85,007,862	S112T	probably benign	Het
Vmn2r71	A	T	7: 85,623,634	D552V	probably benign	Het
Vmn2r76	A	G	7: 86,228,696	Y498H	probably benign	Het
Vmn2r84	A	C	10: 130,391,115	W285G	probably damaging	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Yaf2	T	C	15: 93,285,536	K131R	probably damaging	Het
Zfp141	A	T	7: 42,476,056	Y331N	possibly damaging	Het
Zfp324	G	T	7: 12,971,024	C380F	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102783391	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102758666	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102798098	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102781245	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103333930	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102751425	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102789024	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102736436	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102737085	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102774203	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102754197	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102754197	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGACTGCCTGCTAGACACTTTTC -3'
(R):5'- CCCATGTTAGTGAGCACACACCAG -3'

Sequencing Primer
(F):5'- CTAATGGGCAAATACGTCTGACTG -3'
(R):5'- TTAGTGAGCACACACCAGTTCTC -3'

Posted On

2013-11-07