Incidental Mutation 'R0883:Mast4'
ID80906
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 039050-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102853900 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 50 (K50E)
Ref Sequence ENSEMBL: ENSMUSP00000096808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000164111] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: K50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: K50E

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164111
AA Change: K230E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751
AA Change: K230E

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166336
AA Change: K45E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751
AA Change: K45E

DomainStartEndE-ValueType
Pfam:DUF1908 71 212 1.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166726
AA Change: K230E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: K230E

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166867
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: K230E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: K230E

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167462
AA Change: K38E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: K38E

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: K38E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: K38E

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172264
AA Change: K23E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: K23E

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: K62E
Meta Mutation Damage Score 0.0931 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mbd5 A G 2: 49,256,689 T304A possibly damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Slit2 A G 5: 48,245,573 probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc13a G A 8: 71,642,173 R1272* probably null Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTGCCTGCTAGACACTTTTC -3'
(R):5'- CCCATGTTAGTGAGCACACACCAG -3'

Sequencing Primer
(F):5'- CTAATGGGCAAATACGTCTGACTG -3'
(R):5'- TTAGTGAGCACACACCAGTTCTC -3'
Posted On2013-11-07