Incidental Mutation 'R0931:Psmc1'
ID80913
Institutional Source Beutler Lab
Gene Symbol Psmc1
Ensembl Gene ENSMUSG00000021178
Gene Nameprotease (prosome, macropain) 26S subunit, ATPase 1
SynonymsS4, Rpt2/S4, rpt2, P26s4
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0931 (G1)
Quality Score193
Status Validated
Chromosome12
Chromosomal Location100110154-100123405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100119082 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000021595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595]
Predicted Effect probably damaging
Transcript: ENSMUST00000021595
AA Change: L234P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: L234P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223078
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Psmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Psmc1 APN 12 100113078 missense probably damaging 1.00
IGL02445:Psmc1 APN 12 100114828 splice site probably benign
IGL02605:Psmc1 APN 12 100119127 missense probably damaging 1.00
R0018:Psmc1 UTSW 12 100116692 splice site probably benign
R0018:Psmc1 UTSW 12 100116692 splice site probably benign
R0427:Psmc1 UTSW 12 100119228 missense probably damaging 0.96
R0534:Psmc1 UTSW 12 100120130 missense possibly damaging 0.79
R1937:Psmc1 UTSW 12 100114843 missense probably benign 0.26
R2405:Psmc1 UTSW 12 100120103 missense probably benign 0.03
R5063:Psmc1 UTSW 12 100115475 missense probably damaging 0.97
R5293:Psmc1 UTSW 12 100115472 missense probably benign 0.11
R5346:Psmc1 UTSW 12 100120100 missense probably damaging 0.99
R5542:Psmc1 UTSW 12 100120140 critical splice donor site probably null
R7513:Psmc1 UTSW 12 100115514 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCTCAGGGTGTGAAAATAACCAGGT -3'
(R):5'- TCAATGAACACGATGGACGGCG -3'

Sequencing Primer
(F):5'- tgaaggtggaggaagggag -3'
(R):5'- AACCACTCGCAAGAAAGTGG -3'
Posted On2013-11-07