Incidental Mutation 'R0931:Psmc1'
ID |
80913 |
Institutional Source |
Beutler Lab
|
Gene Symbol |
Psmc1
|
Ensembl Gene |
ENSMUSG00000021178 |
Gene Name |
protease (prosome, macropain) 26S subunit, ATPase 1 |
Synonyms |
P26s4, Rpt2/S4, rpt2, S4 |
MMRRC Submission |
039075-MU
|
Accession Numbers |
|
Essential gene? |
Essential
(E-score: 1.000)
|
Stock # |
R0931 (G1)
|
Quality Score |
193 |
Status
|
Validated
|
Chromosome |
12 |
Chromosomal Location |
100076461-100089623 bp(+) (GRCm39) |
Type of Mutation |
missense |
DNA Base Change (assembly) |
T to C
at 100085341 bp (GRCm39)
|
Zygosity |
Heterozygous |
Amino Acid Change |
Leucine to Proline
at position 234
(L234P)
|
Ref Sequence |
ENSEMBL: ENSMUSP00000021595
(fasta)
|
Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000021595]
|
AlphaFold |
P62192 |
Predicted Effect |
probably damaging
Transcript: ENSMUST00000021595
AA Change: L234P
PolyPhen 2
Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
|
SMART Domains |
Protein: ENSMUSP00000021595 Gene: ENSMUSG00000021178 AA Change: L234P
Domain | Start | End | E-Value | Type |
low complexity region
|
7 |
24 |
N/A |
INTRINSIC |
low complexity region
|
27 |
43 |
N/A |
INTRINSIC |
AAA
|
218 |
357 |
1.57e-23 |
SMART |
|
Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000221308
|
Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000222374
|
Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000223078
|
Meta Mutation Damage Score |
0.6467 |
Coding Region Coverage |
- 1x: 99.4%
- 3x: 98.9%
- 10x: 97.7%
- 20x: 96.0%
|
Validation Efficiency |
100% (42/42) |
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
|
Allele List at MGI |
|
Other mutations in this stock |
Total: 40 list
Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
Adamtsl1 |
G |
A |
4: 86,168,084 (GRCm39) |
A476T |
probably benign |
Het |
Ajm1 |
T |
C |
2: 25,468,501 (GRCm39) |
E470G |
possibly damaging |
Het |
Aknad1 |
T |
C |
3: 108,659,339 (GRCm39) |
S118P |
probably damaging |
Het |
Arhgap20 |
A |
G |
9: 51,728,041 (GRCm39) |
T85A |
probably benign |
Het |
Astn2 |
A |
G |
4: 65,566,530 (GRCm39) |
L824P |
probably damaging |
Het |
Ccr1 |
C |
A |
9: 123,763,827 (GRCm39) |
K234N |
probably damaging |
Het |
Cfap46 |
T |
C |
7: 139,235,757 (GRCm39) |
R203G |
probably damaging |
Het |
Col8a1 |
A |
G |
16: 57,448,931 (GRCm39) |
I193T |
unknown |
Het |
Cpa2 |
T |
C |
6: 30,552,070 (GRCm39) |
|
probably benign |
Het |
Crabp1 |
T |
C |
9: 54,675,717 (GRCm39) |
L100P |
possibly damaging |
Het |
Cspp1 |
A |
T |
1: 10,174,511 (GRCm39) |
R655W |
probably damaging |
Het |
Ddx1 |
A |
T |
12: 13,287,818 (GRCm39) |
|
probably benign |
Het |
Dnah7b |
T |
G |
1: 46,138,772 (GRCm39) |
|
probably benign |
Het |
Dzip3 |
A |
G |
16: 48,771,921 (GRCm39) |
S583P |
probably damaging |
Het |
Exosc1 |
A |
G |
19: 41,921,676 (GRCm39) |
|
probably benign |
Het |
Fhip1a |
A |
G |
3: 85,580,550 (GRCm39) |
S552P |
probably benign |
Het |
Gas7 |
A |
T |
11: 67,543,751 (GRCm39) |
|
probably benign |
Het |
Gss |
A |
T |
2: 155,409,609 (GRCm39) |
|
probably benign |
Het |
Hdhd3 |
G |
A |
4: 62,417,757 (GRCm39) |
R140* |
probably null |
Het |
Irx2 |
T |
A |
13: 72,779,675 (GRCm39) |
S320T |
possibly damaging |
Het |
Kcnf1 |
T |
C |
12: 17,225,142 (GRCm39) |
S360G |
possibly damaging |
Het |
Klk1b4 |
T |
C |
7: 43,860,480 (GRCm39) |
L166P |
probably damaging |
Het |
Klri1 |
A |
T |
6: 129,674,381 (GRCm39) |
|
probably benign |
Het |
Mettl27 |
T |
C |
5: 134,963,285 (GRCm39) |
|
probably benign |
Het |
Myrfl |
T |
A |
10: 116,675,354 (GRCm39) |
H193L |
probably benign |
Het |
Nbas |
C |
T |
12: 13,381,115 (GRCm39) |
|
probably benign |
Het |
Or10ac1 |
C |
A |
6: 42,515,020 (GRCm39) |
R312L |
probably benign |
Het |
Or52b2 |
A |
T |
7: 104,986,736 (GRCm39) |
Y62* |
probably null |
Het |
Papolg |
A |
G |
11: 23,832,257 (GRCm39) |
I177T |
probably damaging |
Het |
Pdcd1 |
A |
G |
1: 93,967,238 (GRCm39) |
V220A |
probably benign |
Het |
Rasa2 |
A |
T |
9: 96,434,457 (GRCm39) |
M610K |
possibly damaging |
Het |
Ryr3 |
A |
G |
2: 112,484,047 (GRCm39) |
F3930S |
probably damaging |
Het |
Sacs |
G |
A |
14: 61,440,944 (GRCm39) |
V997I |
probably benign |
Het |
Setdb2 |
A |
G |
14: 59,660,945 (GRCm39) |
|
probably benign |
Het |
Ssu2 |
C |
A |
6: 112,361,359 (GRCm39) |
L32F |
probably damaging |
Het |
Taar1 |
A |
T |
10: 23,797,181 (GRCm39) |
N293I |
probably damaging |
Het |
Ttn |
A |
G |
2: 76,611,846 (GRCm39) |
|
probably benign |
Het |
Vmn2r49 |
T |
C |
7: 9,720,325 (GRCm39) |
M389V |
possibly damaging |
Het |
Wdr7 |
T |
C |
18: 63,998,371 (GRCm39) |
V1106A |
probably benign |
Het |
Zfp324 |
A |
G |
7: 12,700,185 (GRCm39) |
I15V |
probably benign |
Het |
|
Other mutations in Psmc1 |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01700:Psmc1
|
APN |
12 |
100,079,337 (GRCm39) |
missense |
probably damaging |
1.00 |
IGL02445:Psmc1
|
APN |
12 |
100,081,087 (GRCm39) |
splice site |
probably benign |
|
IGL02605:Psmc1
|
APN |
12 |
100,085,386 (GRCm39) |
missense |
probably damaging |
1.00 |
R0018:Psmc1
|
UTSW |
12 |
100,082,951 (GRCm39) |
splice site |
probably benign |
|
R0018:Psmc1
|
UTSW |
12 |
100,082,951 (GRCm39) |
splice site |
probably benign |
|
R0427:Psmc1
|
UTSW |
12 |
100,085,487 (GRCm39) |
missense |
probably damaging |
0.96 |
R0534:Psmc1
|
UTSW |
12 |
100,086,389 (GRCm39) |
missense |
possibly damaging |
0.79 |
R1937:Psmc1
|
UTSW |
12 |
100,081,102 (GRCm39) |
missense |
probably benign |
0.26 |
R2405:Psmc1
|
UTSW |
12 |
100,086,362 (GRCm39) |
missense |
probably benign |
0.03 |
R5063:Psmc1
|
UTSW |
12 |
100,081,734 (GRCm39) |
missense |
probably damaging |
0.97 |
R5293:Psmc1
|
UTSW |
12 |
100,081,731 (GRCm39) |
missense |
probably benign |
0.11 |
R5346:Psmc1
|
UTSW |
12 |
100,086,359 (GRCm39) |
missense |
probably damaging |
0.99 |
R5542:Psmc1
|
UTSW |
12 |
100,086,399 (GRCm39) |
critical splice donor site |
probably null |
|
R7513:Psmc1
|
UTSW |
12 |
100,081,773 (GRCm39) |
missense |
probably benign |
0.19 |
R7993:Psmc1
|
UTSW |
12 |
100,081,824 (GRCm39) |
missense |
probably benign |
0.01 |
R8489:Psmc1
|
UTSW |
12 |
100,089,356 (GRCm39) |
missense |
probably benign |
0.00 |
|
Predicted Primers |
PCR Primer
(F):5'- GCTCAGGGTGTGAAAATAACCAGGT -3'
(R):5'- TCAATGAACACGATGGACGGCG -3'
Sequencing Primer
(F):5'- tgaaggtggaggaagggag -3'
(R):5'- AACCACTCGCAAGAAAGTGG -3'
|
Posted On |
2013-11-07 |