Incidental Mutation 'R0931:Psmc1'
ID 80913
Institutional Source Beutler Lab
Gene Symbol Psmc1
Ensembl Gene ENSMUSG00000021178
Gene Name protease (prosome, macropain) 26S subunit, ATPase 1
Synonyms P26s4, Rpt2/S4, rpt2, S4
MMRRC Submission 039075-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0931 (G1)
Quality Score 193
Status Validated
Chromosome 12
Chromosomal Location 100076461-100089623 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100085341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000021595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595]
AlphaFold P62192
Predicted Effect probably damaging
Transcript: ENSMUST00000021595
AA Change: L234P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: L234P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223078
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,168,084 (GRCm39) A476T probably benign Het
Ajm1 T C 2: 25,468,501 (GRCm39) E470G possibly damaging Het
Aknad1 T C 3: 108,659,339 (GRCm39) S118P probably damaging Het
Arhgap20 A G 9: 51,728,041 (GRCm39) T85A probably benign Het
Astn2 A G 4: 65,566,530 (GRCm39) L824P probably damaging Het
Ccr1 C A 9: 123,763,827 (GRCm39) K234N probably damaging Het
Cfap46 T C 7: 139,235,757 (GRCm39) R203G probably damaging Het
Col8a1 A G 16: 57,448,931 (GRCm39) I193T unknown Het
Cpa2 T C 6: 30,552,070 (GRCm39) probably benign Het
Crabp1 T C 9: 54,675,717 (GRCm39) L100P possibly damaging Het
Cspp1 A T 1: 10,174,511 (GRCm39) R655W probably damaging Het
Ddx1 A T 12: 13,287,818 (GRCm39) probably benign Het
Dnah7b T G 1: 46,138,772 (GRCm39) probably benign Het
Dzip3 A G 16: 48,771,921 (GRCm39) S583P probably damaging Het
Exosc1 A G 19: 41,921,676 (GRCm39) probably benign Het
Fhip1a A G 3: 85,580,550 (GRCm39) S552P probably benign Het
Gas7 A T 11: 67,543,751 (GRCm39) probably benign Het
Gss A T 2: 155,409,609 (GRCm39) probably benign Het
Hdhd3 G A 4: 62,417,757 (GRCm39) R140* probably null Het
Irx2 T A 13: 72,779,675 (GRCm39) S320T possibly damaging Het
Kcnf1 T C 12: 17,225,142 (GRCm39) S360G possibly damaging Het
Klk1b4 T C 7: 43,860,480 (GRCm39) L166P probably damaging Het
Klri1 A T 6: 129,674,381 (GRCm39) probably benign Het
Mettl27 T C 5: 134,963,285 (GRCm39) probably benign Het
Myrfl T A 10: 116,675,354 (GRCm39) H193L probably benign Het
Nbas C T 12: 13,381,115 (GRCm39) probably benign Het
Or10ac1 C A 6: 42,515,020 (GRCm39) R312L probably benign Het
Or52b2 A T 7: 104,986,736 (GRCm39) Y62* probably null Het
Papolg A G 11: 23,832,257 (GRCm39) I177T probably damaging Het
Pdcd1 A G 1: 93,967,238 (GRCm39) V220A probably benign Het
Rasa2 A T 9: 96,434,457 (GRCm39) M610K possibly damaging Het
Ryr3 A G 2: 112,484,047 (GRCm39) F3930S probably damaging Het
Sacs G A 14: 61,440,944 (GRCm39) V997I probably benign Het
Setdb2 A G 14: 59,660,945 (GRCm39) probably benign Het
Ssu2 C A 6: 112,361,359 (GRCm39) L32F probably damaging Het
Taar1 A T 10: 23,797,181 (GRCm39) N293I probably damaging Het
Ttn A G 2: 76,611,846 (GRCm39) probably benign Het
Vmn2r49 T C 7: 9,720,325 (GRCm39) M389V possibly damaging Het
Wdr7 T C 18: 63,998,371 (GRCm39) V1106A probably benign Het
Zfp324 A G 7: 12,700,185 (GRCm39) I15V probably benign Het
Other mutations in Psmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Psmc1 APN 12 100,079,337 (GRCm39) missense probably damaging 1.00
IGL02445:Psmc1 APN 12 100,081,087 (GRCm39) splice site probably benign
IGL02605:Psmc1 APN 12 100,085,386 (GRCm39) missense probably damaging 1.00
R0018:Psmc1 UTSW 12 100,082,951 (GRCm39) splice site probably benign
R0018:Psmc1 UTSW 12 100,082,951 (GRCm39) splice site probably benign
R0427:Psmc1 UTSW 12 100,085,487 (GRCm39) missense probably damaging 0.96
R0534:Psmc1 UTSW 12 100,086,389 (GRCm39) missense possibly damaging 0.79
R1937:Psmc1 UTSW 12 100,081,102 (GRCm39) missense probably benign 0.26
R2405:Psmc1 UTSW 12 100,086,362 (GRCm39) missense probably benign 0.03
R5063:Psmc1 UTSW 12 100,081,734 (GRCm39) missense probably damaging 0.97
R5293:Psmc1 UTSW 12 100,081,731 (GRCm39) missense probably benign 0.11
R5346:Psmc1 UTSW 12 100,086,359 (GRCm39) missense probably damaging 0.99
R5542:Psmc1 UTSW 12 100,086,399 (GRCm39) critical splice donor site probably null
R7513:Psmc1 UTSW 12 100,081,773 (GRCm39) missense probably benign 0.19
R7993:Psmc1 UTSW 12 100,081,824 (GRCm39) missense probably benign 0.01
R8489:Psmc1 UTSW 12 100,089,356 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCAGGGTGTGAAAATAACCAGGT -3'
(R):5'- TCAATGAACACGATGGACGGCG -3'

Sequencing Primer
(F):5'- tgaaggtggaggaagggag -3'
(R):5'- AACCACTCGCAAGAAAGTGG -3'
Posted On 2013-11-07