Incidental Mutation 'R0931:Irx2'
ID80915
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene NameIroquois homeobox 2
SynonymsIRX6
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R0931 (G1)
Quality Score115
Status Validated
Chromosome13
Chromosomal Location72628820-72634198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72631556 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 320 (S320T)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074372
AA Change: S320T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: S320T

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72631310 missense probably damaging 1.00
R0647:Irx2 UTSW 13 72630680 missense probably damaging 1.00
R0783:Irx2 UTSW 13 72632650 critical splice donor site probably null
R0932:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72631466 missense probably benign 0.19
R2844:Irx2 UTSW 13 72631590 missense probably damaging 1.00
R4656:Irx2 UTSW 13 72631298 missense probably damaging 1.00
R4963:Irx2 UTSW 13 72632610 missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72631301 missense probably damaging 1.00
R5523:Irx2 UTSW 13 72631595 missense probably damaging 1.00
R6663:Irx2 UTSW 13 72629129 missense probably damaging 1.00
R7311:Irx2 UTSW 13 72631277 missense probably damaging 0.98
R7411:Irx2 UTSW 13 72629063 start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72630620 missense probably damaging 1.00
R7506:Irx2 UTSW 13 72629209 missense probably damaging 1.00
R7792:Irx2 UTSW 13 72631374 missense possibly damaging 0.88
Z1177:Irx2 UTSW 13 72629089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCGAATCAGGCTCAGAGTGTAAG -3'
(R):5'- CTGTAGTGGGACTCCAGTGAATGC -3'

Sequencing Primer
(F):5'- CAGGCTCAGAGTGTAAGGACAAG -3'
(R):5'- TATTGTACCGCAGAAGGCCC -3'
Posted On2013-11-07