Incidental Mutation 'R0932:Bahd1'
ID80940
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118915927 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 9 (L9P)
Ref Sequence ENSEMBL: ENSMUSP00000043130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000151162]
Predicted Effect probably damaging
Transcript: ENSMUST00000036578
AA Change: L9P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: L9P

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151162
AA Change: L9P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118998
Gene: ENSMUSG00000040007
AA Change: L9P

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
Meta Mutation Damage Score 0.1257 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATGGATTTGCCCATCCCCTAC -3'
(R):5'- CACTTTGCAGGCTTTGGGCTTC -3'

Sequencing Primer
(F):5'- GTCCTTGAACAGCTACTGAGAGTC -3'
(R):5'- CTCGGGAACCAGTGAACG -3'
Posted On2013-11-07