Incidental Mutation 'R0932:Cds1'
ID80962
Institutional Source Beutler Lab
Gene Symbol Cds1
Ensembl Gene ENSMUSG00000029330
Gene NameCDP-diacylglycerol synthase 1
Synonyms4833409J18Rik, phosphatidate cytidylyltransferase
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location101765130-101823858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101797025 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 122 (C122S)
Ref Sequence ENSEMBL: ENSMUSP00000031273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031273]
Predicted Effect probably damaging
Transcript: ENSMUST00000031273
AA Change: C122S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: C122S

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:CTP_transf_1 87 417 6.4e-89 PFAM
low complexity region 427 439 N/A INTRINSIC
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Cds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cds1 APN 5 101809901 missense probably damaging 0.99
IGL02052:Cds1 APN 5 101814472 missense probably benign 0.01
IGL02238:Cds1 APN 5 101814436 missense possibly damaging 0.84
IGL02449:Cds1 APN 5 101815928 missense probably damaging 1.00
IGL02833:Cds1 APN 5 101814466 missense possibly damaging 0.81
IGL02973:Cds1 APN 5 101812510 missense probably damaging 0.99
IGL02987:Cds1 APN 5 101812525 missense possibly damaging 0.85
R0076:Cds1 UTSW 5 101817840 splice site probably benign
R0200:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0285:Cds1 UTSW 5 101797038 missense probably damaging 1.00
R0608:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R1444:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R1585:Cds1 UTSW 5 101817962 splice site probably benign
R1781:Cds1 UTSW 5 101812550 missense possibly damaging 0.78
R2126:Cds1 UTSW 5 101812550 missense probably benign 0.34
R4804:Cds1 UTSW 5 101821523 missense probably damaging 1.00
R4990:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R5176:Cds1 UTSW 5 101781420 missense possibly damaging 0.87
R5330:Cds1 UTSW 5 101798495 missense probably damaging 1.00
R5331:Cds1 UTSW 5 101798495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCACCGACCTTCATTTAAAC -3'
(R):5'- AAATTCAGTGGCTCCGCCTTGCTC -3'

Sequencing Primer
(F):5'- AAACATCCGTCTGCTACTCGATTAG -3'
(R):5'- CTTTCTCCAGAATCGTCCTGTG -3'
Posted On2013-11-07