Incidental Mutation 'R0932:Gm4553'
ID80980
Institutional Source Beutler Lab
Gene Symbol Gm4553
Ensembl Gene ENSMUSG00000090471
Gene Namepredicted gene 4553
Synonyms
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0932 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142164696-142165739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142165686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 2 (S2G)
Ref Sequence ENSEMBL: ENSMUSP00000147863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168049] [ENSMUST00000210925]
Predicted Effect unknown
Transcript: ENSMUST00000168049
AA Change: S18G
SMART Domains Protein: ENSMUSP00000131778
Gene: ENSMUSG00000090471
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 18 238 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000210925
AA Change: S2G
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Gm4553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Gm4553 APN 7 142165227 missense unknown
IGL00324:Gm4553 APN 7 142165227 missense unknown
IGL00325:Gm4553 APN 7 142165227 missense unknown
IGL00329:Gm4553 APN 7 142165227 missense unknown
IGL00332:Gm4553 APN 7 142165227 missense unknown
IGL00336:Gm4553 APN 7 142165227 missense unknown
IGL00337:Gm4553 APN 7 142165227 missense unknown
IGL00338:Gm4553 APN 7 142165227 missense unknown
IGL00339:Gm4553 APN 7 142165227 missense unknown
IGL00340:Gm4553 APN 7 142165227 missense unknown
IGL01348:Gm4553 APN 7 142165172 missense unknown
R0468:Gm4553 UTSW 7 142165625 missense unknown
R0568:Gm4553 UTSW 7 142165620 missense unknown
R4988:Gm4553 UTSW 7 142164992 unclassified probably benign
R5050:Gm4553 UTSW 7 142165036 missense unknown
R7317:Gm4553 UTSW 7 142165420 small deletion probably benign
R7372:Gm4553 UTSW 7 142165420 small deletion probably benign
R7709:Gm4553 UTSW 7 142165647 missense unknown
R7901:Gm4553 UTSW 7 142164865 small deletion probably benign
R8179:Gm4553 UTSW 7 142164857 missense unknown
R8296:Gm4553 UTSW 7 142165721 missense unknown
Predicted Primers PCR Primer
(F):5'- TACAGCCTCCCTTGCAGCCA -3'
(R):5'- ACATGAGCTTCCATTTTGGAGACCATT -3'

Sequencing Primer
(F):5'- TTGCAGCCACCACAGGAG -3'
(R):5'- GGAGACCATTTCCAGGAAATTC -3'
Posted On2013-11-07