Incidental Mutation 'R0932:Krt25'
ID80990
Institutional Source Beutler Lab
Gene Symbol Krt25
Ensembl Gene ENSMUSG00000035831
Gene Namekeratin 25
Synonyms4631426H08Rik, mIRSa1
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99315516-99322951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99321283 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 176 (Q176L)
Ref Sequence ENSEMBL: ENSMUSP00000048439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038004
AA Change: Q176L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831
AA Change: Q176L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Krt25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Krt25 APN 11 99318170 missense probably benign 0.28
IGL02415:Krt25 APN 11 99322572 missense probably damaging 1.00
IGL02816:Krt25 APN 11 99318151 missense probably benign 0.10
Plush UTSW 11 99322635 missense probably damaging 1.00
Sinuous UTSW 11 99322630 missense probably damaging 0.99
R0138:Krt25 UTSW 11 99322698 missense probably benign 0.00
R0219:Krt25 UTSW 11 99318059 missense probably benign 0.01
R1733:Krt25 UTSW 11 99316552 nonsense probably null
R1855:Krt25 UTSW 11 99318315 missense probably damaging 1.00
R2120:Krt25 UTSW 11 99321197 missense probably benign 0.01
R2504:Krt25 UTSW 11 99317296 nonsense probably null
R3615:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R3616:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R4590:Krt25 UTSW 11 99318028 intron probably benign
R6250:Krt25 UTSW 11 99321163 missense probably damaging 1.00
R6331:Krt25 UTSW 11 99317427 missense probably damaging 1.00
R6927:Krt25 UTSW 11 99317379 missense probably damaging 1.00
R7067:Krt25 UTSW 11 99317383 missense probably benign 0.01
R7289:Krt25 UTSW 11 99321272 missense probably benign 0.15
R7360:Krt25 UTSW 11 99317406 missense probably benign 0.01
R8057:Krt25 UTSW 11 99317343 missense probably benign 0.44
R8090:Krt25 UTSW 11 99316590 critical splice acceptor site probably null
Z1176:Krt25 UTSW 11 99322822 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCATCACCTGCAAAGAGAAGCTGG -3'
(R):5'- GCCATGTTAGGGGCTATTCAAGGG -3'

Sequencing Primer
(F):5'- AAGCTGGCCTCCTGTGATG -3'
(R):5'- aaacaaacaaacaaacaaacaaacaG -3'
Posted On2013-11-07