Incidental Mutation 'R0932:Rnf144b'
ID80991
Institutional Source Beutler Lab
Gene Symbol Rnf144b
Ensembl Gene ENSMUSG00000038068
Gene Namering finger protein 144B
SynonymsIbrdc2, E130105P19Rik
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47122656-47247991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47220525 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 66 (R66L)
Ref Sequence ENSEMBL: ENSMUSP00000105738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068891] [ENSMUST00000110111]
Predicted Effect probably null
Transcript: ENSMUST00000068891
AA Change: R66L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068
AA Change: R66L

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110111
AA Change: R66L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068
AA Change: R66L

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Rnf144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Rnf144b APN 13 47220488 splice site probably benign
IGL00987:Rnf144b APN 13 47207493 missense possibly damaging 0.57
IGL02712:Rnf144b APN 13 47239779 missense probably damaging 1.00
IGL03002:Rnf144b APN 13 47242883 missense probably damaging 1.00
R0418:Rnf144b UTSW 13 47244490 missense probably benign 0.00
R0464:Rnf144b UTSW 13 47242887 nonsense probably null
R0652:Rnf144b UTSW 13 47220507 missense probably damaging 1.00
R1472:Rnf144b UTSW 13 47242885 missense probably damaging 1.00
R2341:Rnf144b UTSW 13 47220500 missense probably benign 0.05
R4306:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4308:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4523:Rnf144b UTSW 13 47207537 missense probably benign 0.08
R5591:Rnf144b UTSW 13 47242954 critical splice donor site probably null
R7323:Rnf144b UTSW 13 47239782 missense probably damaging 1.00
R7887:Rnf144b UTSW 13 47239811 missense probably damaging 1.00
X0064:Rnf144b UTSW 13 47237464 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCGAGCCAACAGGAATCTAAC -3'
(R):5'- CTTTCAACCTCAGACCAGCTCTGTG -3'

Sequencing Primer
(F):5'- GCATTCTTTCCAAAGTGATGGC -3'
(R):5'- AGATAAACGGCTGCGCTC -3'
Posted On2013-11-07