Incidental Mutation 'R0932:Irx2'
ID80992
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene NameIroquois homeobox 2
SynonymsIRX6
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location72628820-72634198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72631556 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 320 (S320T)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
AlphaFold P81066
Predicted Effect possibly damaging
Transcript: ENSMUST00000074372
AA Change: S320T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: S320T

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Ibtk C T 9: 85,735,046 G158R probably damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72631310 missense probably damaging 1.00
R0647:Irx2 UTSW 13 72630680 missense probably damaging 1.00
R0783:Irx2 UTSW 13 72632650 critical splice donor site probably null
R0931:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72631466 missense probably benign 0.19
R2844:Irx2 UTSW 13 72631590 missense probably damaging 1.00
R4656:Irx2 UTSW 13 72631298 missense probably damaging 1.00
R4963:Irx2 UTSW 13 72632610 missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72631301 missense probably damaging 1.00
R5523:Irx2 UTSW 13 72631595 missense probably damaging 1.00
R6663:Irx2 UTSW 13 72629129 missense probably damaging 1.00
R7311:Irx2 UTSW 13 72631277 missense probably damaging 0.98
R7411:Irx2 UTSW 13 72629063 start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72630620 missense probably damaging 1.00
R7506:Irx2 UTSW 13 72629209 missense probably damaging 1.00
R7792:Irx2 UTSW 13 72631374 missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72629224 missense probably benign 0.02
R9083:Irx2 UTSW 13 72629273 missense possibly damaging 0.94
Z1177:Irx2 UTSW 13 72629089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCGAATCAGGCTCAGAGTGTAAG -3'
(R):5'- CTGTAGTGGGACTCCAGTGAATGC -3'

Sequencing Primer
(F):5'- CAGGCTCAGAGTGTAAGGACAAG -3'
(R):5'- TATTGTACCGCAGAAGGCCC -3'
Posted On2013-11-07