Mutagenetix > Incidental Mutations

Incidental Mutation 'R0884:Phlpp1'

80995

Institutional Source

Beutler Lab

Gene Symbol

Phlpp1

Ensembl Gene

ENSMUSG00000044340

Gene Name

PH domain and leucine rich repeat protein phosphatase 1

Synonyms

Phlpp, Plekhe1

MMRRC Submission

039051-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R0884 (G1)

Quality Score

203

Status

Not validated

Chromosome

Chromosomal Location

106171752-106394250 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 106389665 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000056530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061047]

Predicted Effect

probably null
Transcript: ENSMUST00000061047

SMART Domains

Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340

Domain	Start	End	E-Value	Type
low complexity region	3	9	N/A	INTRINSIC
low complexity region	21	27	N/A	INTRINSIC
low complexity region	35	96	N/A	INTRINSIC
low complexity region	97	143	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	227	235	N/A	INTRINSIC
low complexity region	257	277	N/A	INTRINSIC
low complexity region	299	313	N/A	INTRINSIC
low complexity region	335	345	N/A	INTRINSIC
low complexity region	355	369	N/A	INTRINSIC
PH	493	594	3.16e-2	SMART
LRR	615	634	4.75e2	SMART
LRR	648	669	7.16e0	SMART
LRR	669	688	1.48e1	SMART
LRR	692	714	2.14e1	SMART
LRR	715	738	1.37e1	SMART
LRR	786	809	3.27e1	SMART
LRR	849	868	8.11e0	SMART
LRR	872	895	1.97e1	SMART
LRR	895	914	2.55e1	SMART
LRR	919	940	1.86e1	SMART
LRR	941	960	1.67e1	SMART
LRR	991	1010	2.13e1	SMART
LRR	1015	1038	5.11e0	SMART
PP2Cc	1121	1376	2.62e-58	SMART
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1424	1445	N/A	INTRINSIC
Blast:PP2Cc	1463	1555	2e-39	BLAST
low complexity region	1608	1624	N/A	INTRINSIC
low complexity region	1640	1671	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adam6b	A	T	12: 113,490,995	R477S	probably damaging	Het
Aqp7	T	A	4: 41,034,929	T175S	possibly damaging	Het
Bclaf1	A	T	10: 20,322,076	R22*	probably null	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Bicc1	A	C	10: 70,958,847	V160G	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cep72	A	G	13: 74,054,881		probably null	Het
Cobl	A	G	11: 12,375,908	I196T	possibly damaging	Het
Cux1	T	G	5: 136,307,835	D941A	probably damaging	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Depdc5	T	A	5: 32,917,978	V500D	possibly damaging	Het
Dhx35	T	C	2: 158,831,711	I354T	probably damaging	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Eif4g3	C	A	4: 138,151,776	N588K	possibly damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Fam53a	T	C	5: 33,600,816	E321G	probably benign	Het
Fat4	C	A	3: 38,982,858	T3553K	possibly damaging	Het
Fer1l4	T	C	2: 156,019,313	T1978A	possibly damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Gje1	G	T	10: 14,716,740	S99R	possibly damaging	Het
Gm13083	A	G	4: 143,615,184	D61G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Gpnmb	T	C	6: 49,047,913	V293A	possibly damaging	Het
Hyi	T	A	4: 118,360,217	I62N	probably damaging	Het
Il4ra	A	G	7: 125,574,663	I267V	probably damaging	Het
Kcnd2	A	T	6: 21,216,541	Q81H	probably benign	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Lpcat4	A	G	2: 112,242,732	N208S	probably damaging	Het
Muc3	T	A	5: 137,142,298	T162S	possibly damaging	Het
Mup3	T	A	4: 62,087,174	I20F	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Pde4d	A	T	13: 109,950,940	I670L	probably damaging	Het
Pigz	A	G	16: 31,941,976		probably null	Het
Prrg4	A	T	2: 104,839,362	Y137N	probably damaging	Het
Rbm28	A	T	6: 29,155,154	S217T	possibly damaging	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Slc6a18	G	T	13: 73,667,037	A384D	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Tln2	C	A	9: 67,370,733	R333L	probably damaging	Het
Tnrc6b	ACAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAG	15: 80,902,555		probably benign	Het
Ttn	G	A	2: 76,751,066	T14834I	possibly damaging	Het
Uggt1	T	C	1: 36,175,078	S177G	probably benign	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het
Zmat4	A	G	8: 24,015,127	T128A	probably benign	Het

Other mutations in Phlpp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Phlpp1	APN	1	106376255	missense	probably damaging	1.00
IGL00848:Phlpp1	APN	1	106339448	missense	probably damaging	1.00
IGL01122:Phlpp1	APN	1	106173436	missense	possibly damaging	0.51
IGL01588:Phlpp1	APN	1	106380389	missense	probably damaging	1.00
IGL02145:Phlpp1	APN	1	106389883	missense	probably damaging	0.96
IGL02417:Phlpp1	APN	1	106392714	missense	probably benign	0.00
IGL02863:Phlpp1	APN	1	106376297	splice site	probably null
IGL03178:Phlpp1	APN	1	106392388	missense	probably damaging	0.99
R0400:Phlpp1	UTSW	1	106392934	missense	probably benign	0.35
R0423:Phlpp1	UTSW	1	106339615	missense	probably benign	0.03
R0449:Phlpp1	UTSW	1	106350578	missense	probably damaging	0.98
R0765:Phlpp1	UTSW	1	106392283	missense	probably damaging	1.00
R1394:Phlpp1	UTSW	1	106350618	missense	possibly damaging	0.82
R1395:Phlpp1	UTSW	1	106350618	missense	possibly damaging	0.82
R1428:Phlpp1	UTSW	1	106380425	splice site	probably null
R1438:Phlpp1	UTSW	1	106173412	missense	possibly damaging	0.53
R1521:Phlpp1	UTSW	1	106392319	missense	probably damaging	1.00
R1572:Phlpp1	UTSW	1	106392789	missense	probably damaging	1.00
R1588:Phlpp1	UTSW	1	106380385	missense	probably damaging	1.00
R1843:Phlpp1	UTSW	1	106343505	missense	probably benign	0.40
R1889:Phlpp1	UTSW	1	106318850	missense	possibly damaging	0.95
R2404:Phlpp1	UTSW	1	106172839	missense	probably benign	0.22
R2942:Phlpp1	UTSW	1	106172772	missense	probably benign	0.00
R3774:Phlpp1	UTSW	1	106393191	small deletion	probably benign
R3832:Phlpp1	UTSW	1	106392597	missense	probably damaging	1.00
R4029:Phlpp1	UTSW	1	106392549	missense	probably damaging	0.98
R4086:Phlpp1	UTSW	1	106347161	missense	probably benign	0.03
R4112:Phlpp1	UTSW	1	106364338	missense	probably damaging	1.00
R4472:Phlpp1	UTSW	1	106386446	missense	probably damaging	1.00
R4654:Phlpp1	UTSW	1	106339501	missense	probably benign	0.00
R4908:Phlpp1	UTSW	1	106389751	missense	probably damaging	1.00
R5027:Phlpp1	UTSW	1	106281471	missense	probably damaging	1.00
R5199:Phlpp1	UTSW	1	106173394	missense	probably damaging	0.98
R5352:Phlpp1	UTSW	1	106172725	missense	probably benign	0.07
R5508:Phlpp1	UTSW	1	106364390	missense	probably benign	0.02
R5570:Phlpp1	UTSW	1	106173432	missense	probably benign	0.01
R5590:Phlpp1	UTSW	1	106392927	missense	possibly damaging	0.95
R5838:Phlpp1	UTSW	1	106347132	nonsense	probably null
R5955:Phlpp1	UTSW	1	106364230	splice site	probably null
R5992:Phlpp1	UTSW	1	106318993	nonsense	probably null
R6469:Phlpp1	UTSW	1	106287103	missense	probably damaging	1.00
R6821:Phlpp1	UTSW	1	106386444	missense	probably damaging	0.98
R6952:Phlpp1	UTSW	1	106172479	missense	probably benign	0.04
R7101:Phlpp1	UTSW	1	106172667	missense	possibly damaging	0.96
R7402:Phlpp1	UTSW	1	106389690	missense	probably damaging	1.00
R7425:Phlpp1	UTSW	1	106392573	missense	probably benign	0.00
R7692:Phlpp1	UTSW	1	106281402	missense	probably damaging	1.00
R7874:Phlpp1	UTSW	1	106389873	missense	probably benign	0.05
R7970:Phlpp1	UTSW	1	106173285	missense	probably damaging	1.00
R8080:Phlpp1	UTSW	1	106392976	missense	probably benign	0.00
R8133:Phlpp1	UTSW	1	106172792	frame shift	probably null
R8224:Phlpp1	UTSW	1	106392618	missense	probably damaging	1.00
R8503:Phlpp1	UTSW	1	106392289	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGGGCTGTATAACTGATGCAGGG -3'
(R):5'- TTTCGACAGAGAACCGTTTGGCAC -3'

Sequencing Primer
(F):5'- ATGAGCAGATACCTCTCTATGTG -3'
(R):5'- CTTGCCAACATTAGCAGAGGTC -3'

Posted On

2013-11-07