Incidental Mutation 'R0975:Tmeff2'
ID81021
Institutional Source Beutler Lab
Gene Symbol Tmeff2
Ensembl Gene ENSMUSG00000026109
Gene Nametransmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms4832418D20Rik, 7630402F16Rik
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0975 (G1)
Quality Score221
Status Validated
Chromosome1
Chromosomal Location50900647-51187270 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 50938205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081851] [ENSMUST00000114565]
Predicted Effect probably benign
Transcript: ENSMUST00000081851
SMART Domains Protein: ENSMUSP00000080533
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
KAZAL 181 227 6.05e-13 SMART
EGF 264 301 3.57e-2 SMART
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114565
SMART Domains Protein: ENSMUSP00000110212
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele display slow postnatal weight gain, decreased white adipose tissue amount, and complete lethality at weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Tmeff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Tmeff2 APN 1 51185450 missense probably damaging 1.00
IGL00707:Tmeff2 APN 1 51133053 splice site probably null
IGL01096:Tmeff2 APN 1 50930546 splice site probably benign
IGL01897:Tmeff2 APN 1 51132210 missense probably damaging 1.00
IGL02797:Tmeff2 APN 1 50928047 missense probably damaging 1.00
IGL03245:Tmeff2 APN 1 51181817 missense probably benign 0.30
R0454:Tmeff2 UTSW 1 50928075 missense possibly damaging 0.92
R1161:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1310:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1457:Tmeff2 UTSW 1 51181867 missense probably damaging 1.00
R3001:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3002:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3424:Tmeff2 UTSW 1 50979617 intron probably benign
R4807:Tmeff2 UTSW 1 50979387 missense probably benign 0.01
R4923:Tmeff2 UTSW 1 50930645 missense probably benign 0.29
R4977:Tmeff2 UTSW 1 50979556 nonsense probably null
R5176:Tmeff2 UTSW 1 51071541 nonsense probably null
R5220:Tmeff2 UTSW 1 50979317 missense probably benign 0.01
R5919:Tmeff2 UTSW 1 51132152 nonsense probably null
R5990:Tmeff2 UTSW 1 50979442 nonsense probably null
R6353:Tmeff2 UTSW 1 51181826 missense probably damaging 1.00
R6358:Tmeff2 UTSW 1 51133114 nonsense probably null
R6925:Tmeff2 UTSW 1 50928021 missense probably damaging 0.99
R7114:Tmeff2 UTSW 1 51185245 splice site probably null
R7163:Tmeff2 UTSW 1 50938344 critical splice donor site probably null
R7332:Tmeff2 UTSW 1 50979440 missense unknown
R7762:Tmeff2 UTSW 1 50979416 missense probably benign 0.04
R8223:Tmeff2 UTSW 1 51133120 critical splice donor site probably null
R8260:Tmeff2 UTSW 1 50938319 missense probably damaging 0.97
R8301:Tmeff2 UTSW 1 51181837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGCTGCCAACACAGATAGCC -3'
(R):5'- AGTCCCAAGTTCATGCACGAGAAG -3'

Sequencing Primer
(F):5'- CAATTGGTCCACTTGACATGAC -3'
(R):5'- gttttttgtttttgtttgttttgtgg -3'
Posted On2013-11-07