Incidental Mutation 'R0975:Olfr353'
ID81027
Institutional Source Beutler Lab
Gene Symbol Olfr353
Ensembl Gene ENSMUSG00000075382
Gene Nameolfactory receptor 353
SynonymsGA_x6K02T2NLDC-33585366-33584431, MOR127-3
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36887293-36892936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36890550 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 99 (M99I)
Ref Sequence ENSEMBL: ENSMUSP00000149378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100149] [ENSMUST00000215925] [ENSMUST00000217215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100149
AA Change: M99I

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097726
Gene: ENSMUSG00000075382
AA Change: M99I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-56 PFAM
Pfam:7tm_1 39 288 3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215925
AA Change: M99I

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217215
AA Change: M99I

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1573 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Olfr353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Olfr353 APN 2 36890719 missense probably damaging 1.00
IGL02944:Olfr353 APN 2 36890788 missense possibly damaging 0.83
R0101:Olfr353 UTSW 2 36890126 missense probably damaging 1.00
R0118:Olfr353 UTSW 2 36890023 missense probably benign 0.07
R0276:Olfr353 UTSW 2 36890023 missense probably benign 0.26
R0944:Olfr353 UTSW 2 36890686 missense probably damaging 1.00
R1895:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R1946:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R2847:Olfr353 UTSW 2 36890524 missense probably damaging 1.00
R4573:Olfr353 UTSW 2 36890190 missense probably damaging 1.00
R4631:Olfr353 UTSW 2 36890618 missense probably benign 0.01
R4647:Olfr353 UTSW 2 36890651 missense probably benign 0.00
R4918:Olfr353 UTSW 2 36890332 missense probably damaging 0.98
R4967:Olfr353 UTSW 2 36890707 missense probably damaging 1.00
R5102:Olfr353 UTSW 2 36890044 missense possibly damaging 0.87
R5188:Olfr353 UTSW 2 36890393 missense probably benign
R5392:Olfr353 UTSW 2 36890674 missense probably benign 0.34
R5608:Olfr353 UTSW 2 36890515 missense probably damaging 1.00
R6527:Olfr353 UTSW 2 36890582 missense probably benign 0.02
R8508:Olfr353 UTSW 2 36890354 missense probably damaging 1.00
X0017:Olfr353 UTSW 2 36889987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGTGAGAACCCAGCACAG -3'
(R):5'- AGGGTTTCCAGAGCAACAGCAG -3'

Sequencing Primer
(F):5'- AGCACAGGGCAAGCATC -3'
(R):5'- ACTGGGAATGTGCTCATCATC -3'
Posted On2013-11-07