Incidental Mutation 'R0975:Hoxd12'
ID81029
Institutional Source Beutler Lab
Gene Symbol Hoxd12
Ensembl Gene ENSMUSG00000001823
Gene Namehomeobox D12
SynonymsHox-4.7, Hox-5.6
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74675013-74677705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74675934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 230 (R230L)
Ref Sequence ENSEMBL: ENSMUSP00000001878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
Predicted Effect probably benign
Transcript: ENSMUST00000001872
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000001878
AA Change: R230L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823
AA Change: R230L

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Meta Mutation Damage Score 0.7630 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit minor forelimb defects affecting carpals, metacarpals, and phalanges, and alterations of smooth muscle layers of the rectum resulting in malformation of the internal anal sphincter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Hoxd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Hoxd12 APN 2 74675427 missense probably damaging 1.00
IGL01324:Hoxd12 APN 2 74675136 missense probably damaging 1.00
IGL02229:Hoxd12 APN 2 74675934 missense probably damaging 1.00
IGL02684:Hoxd12 APN 2 74675561 missense probably benign
R0661:Hoxd12 UTSW 2 74675892 missense probably damaging 0.98
R1931:Hoxd12 UTSW 2 74675513 missense probably benign
R1931:Hoxd12 UTSW 2 74675531 missense probably benign 0.00
R2510:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R2511:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R3946:Hoxd12 UTSW 2 74675427 missense probably damaging 1.00
R5194:Hoxd12 UTSW 2 74675103 missense probably damaging 1.00
R7326:Hoxd12 UTSW 2 74675246 missense possibly damaging 0.48
R7426:Hoxd12 UTSW 2 74675225 missense possibly damaging 0.82
R7972:Hoxd12 UTSW 2 74675925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTAAACAGTGCCCATGCTC -3'
(R):5'- TCATAGACAAGGACAGGTGACCCC -3'

Sequencing Primer
(F):5'- CCCAAGCCAGTTTAGGCAG -3'
(R):5'- GGTTCCTCAGCTACAGACTG -3'
Posted On2013-11-07