Incidental Mutation 'R0884:Fam53a'
ID81030
Institutional Source Beutler Lab
Gene Symbol Fam53a
Ensembl Gene ENSMUSG00000037339
Gene Namefamily with sequence similarity 53, member A
Synonyms5430419M09Rik, 2410018C17Rik, DNTNP
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33600347-33629635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33600816 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 321 (E321G)
Ref Sequence ENSEMBL: ENSMUSP00000070770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045329] [ENSMUST00000065119] [ENSMUST00000065162] [ENSMUST00000150033]
Predicted Effect probably benign
Transcript: ENSMUST00000045329
AA Change: E321G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045539
Gene: ENSMUSG00000037339
AA Change: E321G

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.2e-113 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065119
AA Change: E321G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000070770
Gene: ENSMUSG00000037339
AA Change: E321G

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.3e-112 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065162
SMART Domains Protein: ENSMUSP00000069521
Gene: ENSMUSG00000037339

DomainStartEndE-ValueType
Pfam:FAM53 1 299 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150033
SMART Domains Protein: ENSMUSP00000117350
Gene: ENSMUSG00000037339

DomainStartEndE-ValueType
Pfam:FAM53 1 54 4e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Fam53a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Fam53a APN 5 33600827 missense probably benign 0.09
IGL02326:Fam53a APN 5 33600594 missense probably damaging 1.00
IGL02939:Fam53a APN 5 33607759 missense probably damaging 1.00
IGL02988:Fam53a UTSW 5 33607475 missense probably damaging 1.00
R0054:Fam53a UTSW 5 33607732 missense probably damaging 0.99
R4601:Fam53a UTSW 5 33600663 missense probably benign 0.00
R4808:Fam53a UTSW 5 33607679 missense probably damaging 1.00
R5311:Fam53a UTSW 5 33607736 missense probably damaging 1.00
R6334:Fam53a UTSW 5 33600875 missense probably damaging 1.00
R6525:Fam53a UTSW 5 33607918 missense probably damaging 0.99
R6645:Fam53a UTSW 5 33600784 missense probably benign
R6681:Fam53a UTSW 5 33607840 missense probably damaging 1.00
R6814:Fam53a UTSW 5 33610485 missense probably benign 0.35
R7542:Fam53a UTSW 5 33607471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGTTGTTCTCAATCTGCTCCAAG -3'
(R):5'- ACTCCAGACACATTTAGGGTGGTTCTC -3'

Sequencing Primer
(F):5'- AATCTGCTCCAAGTCCAGGTC -3'
(R):5'- GCAGAGTCCAGGAAACAGTTC -3'
Posted On2013-11-07