Incidental Mutation 'R0884:Cux1'
ID81032
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 136307835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 941 (D941A)
Ref Sequence ENSEMBL: ENSMUSP00000135086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably damaging
Transcript: ENSMUST00000004097
AA Change: D850A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: D850A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175975
AA Change: D928A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: D928A

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: D941A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: D941A

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176486
AA Change: D812A
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: D812A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: D933A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: D933A

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 intron probably null
Predicted Primers PCR Primer
(F):5'- TGCACAATGGGACTCAGCAGAC -3'
(R):5'- CAGCATCCGCAGAGTACTGGAAAG -3'

Sequencing Primer
(F):5'- CTAGGACACTTGCCAGTGG -3'
(R):5'- CAGAGTACTGGAAAGAGTGGC -3'
Posted On2013-11-07