Incidental Mutation 'R0975:Wfdc6b'
ID81033
Institutional Source Beutler Lab
Gene Symbol Wfdc6b
Ensembl Gene ENSMUSG00000070531
Gene NameWAP four-disulfide core domain 6B
SynonymsWfdc6
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164613522-164618212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164613785 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 11 (M11I)
Ref Sequence ENSEMBL: ENSMUSP00000091906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094346] [ENSMUST00000094351] [ENSMUST00000109338] [ENSMUST00000109339]
Predicted Effect probably damaging
Transcript: ENSMUST00000094346
AA Change: M11I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091906
Gene: ENSMUSG00000070531
AA Change: M11I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
WAP 42 84 2.99e-1 SMART
KU 86 139 7.78e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094351
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109338
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109339
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Meta Mutation Damage Score 0.8286 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Wfdc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02874:Wfdc6b APN 2 164617448 critical splice donor site probably null
R0031:Wfdc6b UTSW 2 164613859 missense probably damaging 1.00
R2118:Wfdc6b UTSW 2 164617443 missense probably benign 0.18
R2124:Wfdc6b UTSW 2 164617443 missense probably benign 0.18
R3619:Wfdc6b UTSW 2 164614906 missense probably benign 0.00
R4746:Wfdc6b UTSW 2 164617433 nonsense probably null
R4846:Wfdc6b UTSW 2 164617294 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCCACAGATAATTAGCCCAGAGATGAG -3'
(R):5'- TCCCAGGATATGGGGAAACACTGAC -3'

Sequencing Primer
(F):5'- tgattccacccccagcc -3'
(R):5'- TATGGGGAAACACTGACTCCAAAC -3'
Posted On2013-11-07