Mutagenetix > Incidental Mutation

Incidental Mutation 'R0884:Kcnd2'

81036

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

039051-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R0884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21216541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 81 (Q81H)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably benign
Transcript: ENSMUST00000081542
AA Change: Q81H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: Q81H

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adam6b	A	T	12: 113,490,995	R477S	probably damaging	Het
Aqp7	T	A	4: 41,034,929	T175S	possibly damaging	Het
Bclaf1	A	T	10: 20,322,076	R22*	probably null	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Bicc1	A	C	10: 70,958,847	V160G	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cep72	A	G	13: 74,054,881		probably null	Het
Cobl	A	G	11: 12,375,908	I196T	possibly damaging	Het
Cux1	T	G	5: 136,307,835	D941A	probably damaging	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Depdc5	T	A	5: 32,917,978	V500D	possibly damaging	Het
Dhx35	T	C	2: 158,831,711	I354T	probably damaging	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Eif4g3	C	A	4: 138,151,776	N588K	possibly damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Fam53a	T	C	5: 33,600,816	E321G	probably benign	Het
Fat4	C	A	3: 38,982,858	T3553K	possibly damaging	Het
Fer1l4	T	C	2: 156,019,313	T1978A	possibly damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Gje1	G	T	10: 14,716,740	S99R	possibly damaging	Het
Gm13083	A	G	4: 143,615,184	D61G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Gpnmb	T	C	6: 49,047,913	V293A	possibly damaging	Het
Hyi	T	A	4: 118,360,217	I62N	probably damaging	Het
Il4ra	A	G	7: 125,574,663	I267V	probably damaging	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Lpcat4	A	G	2: 112,242,732	N208S	probably damaging	Het
Muc3	T	A	5: 137,142,298	T162S	possibly damaging	Het
Mup3	T	A	4: 62,087,174	I20F	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Pde4d	A	T	13: 109,950,940	I670L	probably damaging	Het
Phlpp1	T	A	1: 106,389,665		probably null	Het
Pigz	A	G	16: 31,941,976		probably null	Het
Prrg4	A	T	2: 104,839,362	Y137N	probably damaging	Het
Rbm28	A	T	6: 29,155,154	S217T	possibly damaging	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Slc6a18	G	T	13: 73,667,037	A384D	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Tln2	C	A	9: 67,370,733	R333L	probably damaging	Het
Tnrc6b	ACAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAG	15: 80,902,555		probably benign	Het
Ttn	G	A	2: 76,751,066	T14834I	possibly damaging	Het
Uggt1	T	C	1: 36,175,078	S177G	probably benign	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het
Zmat4	A	G	8: 24,015,127	T128A	probably benign	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGTGTTCCTGTGAGCAGTGTCC -3'
(R):5'- GTACTCCTCATAACAGCAGTCGCC -3'

Sequencing Primer
(F):5'- AGCATGGCTGCCCTTTG -3'
(R):5'- CAGCAGTCGCCAATAATTTCTGG -3'

Posted On

2013-11-07