Incidental Mutation 'R0884:Rbm28'
ID81038
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29155154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 217 (S217T)
Ref Sequence ENSEMBL: ENSMUSP00000007993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993]
PDB Structure
Solution structure of RRM domain in RNA-binding protein 28 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007993
AA Change: S217T

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701
AA Change: S217T

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178237
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0654:Rbm28 UTSW 6 29128578 missense probably damaging 1.00
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 unclassified probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4421:Rbm28 UTSW 6 29154837 missense probably damaging 1.00
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5378:Rbm28 UTSW 6 29128559 missense probably damaging 0.99
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7351:Rbm28 UTSW 6 29158880 missense probably benign
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
RF056:Rbm28 UTSW 6 29157053 frame shift probably null
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGTCTTCCCTAGTTCTCAGAATGT -3'
(R):5'- GCCCAAACCCTCAGGTGCTCAA -3'

Sequencing Primer
(F):5'- TCTTGTGCACACTCACAGGA -3'
(R):5'- agccctcaaagcccacc -3'
Posted On2013-11-07