Incidental Mutation 'R0975:Trmt10a'
ID81044
Institutional Source Beutler Lab
Gene Symbol Trmt10a
Ensembl Gene ENSMUSG00000004127
Gene NametRNA methyltransferase 10A
Synonyms3110023L08Rik, Rg9mtd2
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138143448-138159821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138156809 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 287 (E287K)
Ref Sequence ENSEMBL: ENSMUSP00000125749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040321] [ENSMUST00000162864]
Predicted Effect probably benign
Transcript: ENSMUST00000040321
AA Change: E287K

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042082
Gene: ENSMUSG00000004127
AA Change: E287K

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 3.7e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161791
Predicted Effect probably benign
Transcript: ENSMUST00000162864
AA Change: E287K

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125749
Gene: ENSMUSG00000004127
AA Change: E287K

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 2.7e-33 PFAM
Meta Mutation Damage Score 0.1221 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the tRNA (Guanine-1)-methyltransferase family. A similar gene in yeast modifies several different tRNA species. Mutations in this gene are associated with microcephaly, short stature, and impaired glucose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating magnesium level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Trmt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00563:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00771:Trmt10a APN 3 138150455 missense probably benign 0.08
IGL01140:Trmt10a APN 3 138156698 splice site probably benign
IGL02869:Trmt10a APN 3 138152184 splice site probably null
R0898:Trmt10a UTSW 3 138149518 missense probably damaging 1.00
R1511:Trmt10a UTSW 3 138152184 splice site probably null
R1872:Trmt10a UTSW 3 138156720 missense probably damaging 1.00
R4856:Trmt10a UTSW 3 138148385 nonsense probably null
R4880:Trmt10a UTSW 3 138152211 missense possibly damaging 0.64
R4886:Trmt10a UTSW 3 138148385 nonsense probably null
R5399:Trmt10a UTSW 3 138147504 missense probably damaging 0.97
R5516:Trmt10a UTSW 3 138152196 missense possibly damaging 0.91
R5994:Trmt10a UTSW 3 138156714 missense probably damaging 1.00
R7272:Trmt10a UTSW 3 138154766 missense probably damaging 1.00
X0028:Trmt10a UTSW 3 138154795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTCTGGGGCTTGAGAACTGAC -3'
(R):5'- GAGCATTCTGTAAAGCACCGCAC -3'

Sequencing Primer
(F):5'- GTTTGTGCCTGATAGATAGCCAAAAG -3'
(R):5'- TTCTCTTAAGCGAGAGGAGGAC -3'
Posted On2013-11-07