Mutagenetix > Incidental Mutations

Incidental Mutation 'R0884:Il4ra'

81053

Institutional Source

Beutler Lab

Gene Symbol

Il4ra

Ensembl Gene

ENSMUSG00000030748

Gene Name

interleukin 4 receptor, alpha

Synonyms

Il4r, IL-4 receptor alpha chain, CD124

MMRRC Submission

039051-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R0884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125552120-125579474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125574663 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 267 (I267V)

Ref Sequence

ENSEMBL: ENSMUSP00000033004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000205985] [ENSMUST00000206846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033004
AA Change: I267V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: I267V

Domain	Start	End	E-Value	Type
Pfam:IL4Ra_N	28	122	9.9e-39	PFAM
FN3	124	211	3.14e0	SMART
low complexity region	369	385	N/A	INTRINSIC
low complexity region	562	574	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	635	647	N/A	INTRINSIC
low complexity region	674	683	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205394

Predicted Effect

probably benign
Transcript: ENSMUST00000205985

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206681

Predicted Effect

probably benign
Transcript: ENSMUST00000206846

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adam6b	A	T	12: 113,490,995	R477S	probably damaging	Het
Aqp7	T	A	4: 41,034,929	T175S	possibly damaging	Het
Bclaf1	A	T	10: 20,322,076	R22*	probably null	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Bicc1	A	C	10: 70,958,847	V160G	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cep72	A	G	13: 74,054,881		probably null	Het
Cobl	A	G	11: 12,375,908	I196T	possibly damaging	Het
Cux1	T	G	5: 136,307,835	D941A	probably damaging	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Depdc5	T	A	5: 32,917,978	V500D	possibly damaging	Het
Dhx35	T	C	2: 158,831,711	I354T	probably damaging	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Eif4g3	C	A	4: 138,151,776	N588K	possibly damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Fam53a	T	C	5: 33,600,816	E321G	probably benign	Het
Fat4	C	A	3: 38,982,858	T3553K	possibly damaging	Het
Fer1l4	T	C	2: 156,019,313	T1978A	possibly damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Gje1	G	T	10: 14,716,740	S99R	possibly damaging	Het
Gm13083	A	G	4: 143,615,184	D61G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Gpnmb	T	C	6: 49,047,913	V293A	possibly damaging	Het
Hyi	T	A	4: 118,360,217	I62N	probably damaging	Het
Kcnd2	A	T	6: 21,216,541	Q81H	probably benign	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Lpcat4	A	G	2: 112,242,732	N208S	probably damaging	Het
Muc3	T	A	5: 137,142,298	T162S	possibly damaging	Het
Mup3	T	A	4: 62,087,174	I20F	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Pde4d	A	T	13: 109,950,940	I670L	probably damaging	Het
Phlpp1	T	A	1: 106,389,665		probably null	Het
Pigz	A	G	16: 31,941,976		probably null	Het
Prrg4	A	T	2: 104,839,362	Y137N	probably damaging	Het
Rbm28	A	T	6: 29,155,154	S217T	possibly damaging	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Slc6a18	G	T	13: 73,667,037	A384D	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Tln2	C	A	9: 67,370,733	R333L	probably damaging	Het
Tnrc6b	ACAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAG	15: 80,902,555		probably benign	Het
Ttn	G	A	2: 76,751,066	T14834I	possibly damaging	Het
Uggt1	T	C	1: 36,175,078	S177G	probably benign	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het
Zmat4	A	G	8: 24,015,127	T128A	probably benign	Het

Other mutations in Il4ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Il4ra	APN	7	125569175	critical splice donor site	probably null
IGL01067:Il4ra	APN	7	125575161	missense	probably benign	0.09
IGL01107:Il4ra	APN	7	125575914	missense	possibly damaging	0.88
IGL02224:Il4ra	APN	7	125570099	splice site	probably benign
IGL02249:Il4ra	APN	7	125567224	missense	probably benign	0.01
IGL02383:Il4ra	APN	7	125571504	missense	probably benign	0.06
IGL02614:Il4ra	APN	7	125575790	nonsense	probably null
IGL02879:Il4ra	APN	7	125576897	missense	possibly damaging	0.88
Haile	UTSW	7	125574717	critical splice donor site	probably null
Lowe	UTSW	7	125567221	missense	probably damaging	1.00
BB006:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
BB016:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
IGL02991:Il4ra	UTSW	7	125575661	missense	possibly damaging	0.70
PIT4418001:Il4ra	UTSW	7	125576338	missense	probably benign	0.01
R0066:Il4ra	UTSW	7	125576231	missense	possibly damaging	0.80
R0127:Il4ra	UTSW	7	125569070	missense	probably damaging	1.00
R0148:Il4ra	UTSW	7	125575537	missense	probably damaging	1.00
R0238:Il4ra	UTSW	7	125575199	splice site	probably benign
R0239:Il4ra	UTSW	7	125575199	splice site	probably benign
R1102:Il4ra	UTSW	7	125574717	critical splice donor site	probably null
R1622:Il4ra	UTSW	7	125570053	missense	possibly damaging	0.87
R1773:Il4ra	UTSW	7	125567182	missense	possibly damaging	0.94
R4510:Il4ra	UTSW	7	125576108	missense	possibly damaging	0.63
R4511:Il4ra	UTSW	7	125576108	missense	possibly damaging	0.63
R4612:Il4ra	UTSW	7	125576083	missense	probably benign	0.14
R5865:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
R5996:Il4ra	UTSW	7	125567221	missense	probably damaging	1.00
R6057:Il4ra	UTSW	7	125571563	missense	probably damaging	1.00
R6246:Il4ra	UTSW	7	125576405	missense	probably benign	0.00
R7218:Il4ra	UTSW	7	125575778	missense	probably benign	0.01
R7624:Il4ra	UTSW	7	125569108	missense	probably damaging	1.00
R7904:Il4ra	UTSW	7	125565673	missense	probably benign	0.05
R7929:Il4ra	UTSW	7	125575176	missense	probably benign	0.00
R8360:Il4ra	UTSW	7	125569966	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCACCTCTCCCAATTCAGAATG -3'
(R):5'- CTGTGACTAGCAGAACATGGCAGG -3'

Sequencing Primer
(F):5'- CTCTCCCAATTCAGAATGGTAGTGG -3'
(R):5'- CACACAGATGTGGGCATGG -3'

Posted On

2013-11-07