Incidental Mutation 'R0975:Sec31a'
ID81056
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 039104-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 100395904 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect probably null
Transcript: ENSMUST00000094578
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182886
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182988
Predicted Effect probably null
Transcript: ENSMUST00000183247
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATTCCAAGGGCTGACAGGCTG -3'
(R):5'- TCTGTGGCATCCATTACCAGATTGC -3'

Sequencing Primer
(F):5'- CTGACAGGCTGAGAAGCACC -3'
(R):5'- GGTTTTCTTCgtctgtgtgtg -3'
Posted On2013-11-07