Incidental Mutation 'R0884:Bclaf1'
ID81065
Institutional Source Beutler Lab
Gene Symbol Bclaf1
Ensembl Gene ENSMUSG00000037608
Gene NameBCL2-associated transcription factor 1
Synonyms5730534O06Rik, 2810454G14Rik, 2700025J07Rik, 2610102K23Rik
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location20312469-20344613 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 20322076 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 22 (R22*)
Ref Sequence ENSEMBL: ENSMUSP00000140428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043881] [ENSMUST00000092678] [ENSMUST00000185800] [ENSMUST00000186100] [ENSMUST00000189158] [ENSMUST00000190156] [ENSMUST00000191438]
Predicted Effect probably null
Transcript: ENSMUST00000043881
AA Change: R22*
SMART Domains Protein: ENSMUSP00000043583
Gene: ENSMUSG00000037608
AA Change: R22*

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 766 1.6e-181 PFAM
low complexity region 793 824 N/A INTRINSIC
low complexity region 861 874 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092678
AA Change: R22*
SMART Domains Protein: ENSMUSP00000090349
Gene: ENSMUSG00000037608
AA Change: R22*

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 789 5.4e-191 PFAM
low complexity region 812 825 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185800
AA Change: R22*
SMART Domains Protein: ENSMUSP00000140623
Gene: ENSMUSG00000037608
AA Change: R22*

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 787 7.2e-191 PFAM
low complexity region 791 822 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186100
AA Change: R22*
SMART Domains Protein: ENSMUSP00000140101
Gene: ENSMUSG00000037608
AA Change: R22*

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 742 6.4e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187338
Predicted Effect probably benign
Transcript: ENSMUST00000189158
Predicted Effect probably null
Transcript: ENSMUST00000190156
AA Change: R22*
SMART Domains Protein: ENSMUSP00000140428
Gene: ENSMUSG00000037608
AA Change: R22*

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 740 4.2e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191438
SMART Domains Protein: ENSMUSP00000140702
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 502 1.3e-140 PFAM
low complexity region 525 538 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215262
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, impaired lung development, and T cell and B cell homeostasis abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Bclaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bclaf1 APN 10 20325999 missense probably damaging 0.99
IGL01087:Bclaf1 APN 10 20325310 missense probably damaging 0.99
IGL02001:Bclaf1 APN 10 20323016 unclassified probably benign
IGL02380:Bclaf1 APN 10 20325367 missense possibly damaging 0.93
IGL02618:Bclaf1 APN 10 20323528 missense probably damaging 1.00
R0629:Bclaf1 UTSW 10 20333426 missense probably damaging 1.00
R1013:Bclaf1 UTSW 10 20332076 splice site probably benign
R1611:Bclaf1 UTSW 10 20323252 unclassified probably benign
R2228:Bclaf1 UTSW 10 20339878 utr 3 prime probably benign
R3689:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R3690:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R4290:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4292:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4831:Bclaf1 UTSW 10 20322126 unclassified probably benign
R5238:Bclaf1 UTSW 10 20332384 intron probably benign
R5254:Bclaf1 UTSW 10 20323536 missense possibly damaging 0.71
R5354:Bclaf1 UTSW 10 20333532 missense probably damaging 1.00
R5386:Bclaf1 UTSW 10 20325592 missense possibly damaging 0.95
R5712:Bclaf1 UTSW 10 20333531 missense probably damaging 1.00
R5982:Bclaf1 UTSW 10 20323063 nonsense probably null
R6147:Bclaf1 UTSW 10 20323425 missense possibly damaging 0.93
R6218:Bclaf1 UTSW 10 20334628 missense probably benign 0.27
R6284:Bclaf1 UTSW 10 20322160 intron probably null
R6738:Bclaf1 UTSW 10 20323769 missense possibly damaging 0.91
R7085:Bclaf1 UTSW 10 20322022 missense unknown
R7768:Bclaf1 UTSW 10 20339771 missense probably benign 0.18
R7814:Bclaf1 UTSW 10 20334619 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCTGACATTGCTCCGAAGTTGGTTG -3'
(R):5'- TTGAGAACGGTACACTGATGGCTTG -3'

Sequencing Primer
(F):5'- TTAGTACCTTAAGCAGGTGAAAGTG -3'
(R):5'- CTGATGGCTTGAGTATGTCATACAC -3'
Posted On2013-11-07