Mutagenetix > Incidental Mutations

Incidental Mutation 'R0884:Cobl'

81070

Institutional Source

Beutler Lab

Gene Symbol

Cobl

Ensembl Gene

ENSMUSG00000020173

Gene Name

cordon-bleu WH2 repeat

Synonyms

C530045F18Rik

MMRRC Submission

039051-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12236608-12464960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12375908 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 196 (I196T)

Ref Sequence

ENSEMBL: ENSMUSP00000134372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046755
AA Change: I196T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: I196T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	144	235	2.2e-46	PFAM
low complexity region	328	333	N/A	INTRINSIC
low complexity region	360	376	N/A	INTRINSIC
low complexity region	408	433	N/A	INTRINSIC
low complexity region	468	482	N/A	INTRINSIC
low complexity region	526	541	N/A	INTRINSIC
coiled coil region	564	589	N/A	INTRINSIC
WH2	1185	1205	1.32e0	SMART
WH2	1225	1245	6.36e-3	SMART
low complexity region	1276	1296	N/A	INTRINSIC
WH2	1313	1333	3.91e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109650
AA Change: I196T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: I196T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.6e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	444	459	N/A	INTRINSIC
coiled coil region	482	507	N/A	INTRINSIC
WH2	1103	1123	1.32e0	SMART
WH2	1143	1163	6.36e-3	SMART
low complexity region	1194	1214	N/A	INTRINSIC
WH2	1231	1251	3.91e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109651
AA Change: I196T

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: I196T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.2e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	383	408	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
coiled coil region	539	564	N/A	INTRINSIC
WH2	1160	1180	1.32e0	SMART
WH2	1200	1220	6.36e-3	SMART
low complexity region	1251	1271	N/A	INTRINSIC
WH2	1288	1308	3.91e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130572

Predicted Effect

unknown
Transcript: ENSMUST00000146067
AA Change: I87T

SMART Domains

Protein: ENSMUSP00000119008
Gene: ENSMUSG00000020173
AA Change: I87T

Domain	Start	End	E-Value	Type
Pfam:Cobl	35	142	5e-43	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172919
AA Change: I196T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173
AA Change: I196T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.6e-41	PFAM
low complexity region	328	333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172956
AA Change: I196T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173
AA Change: I196T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.4e-41	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174874
AA Change: I189T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: I189T

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
Pfam:Cobl	175	253	1.2e-40	PFAM
low complexity region	321	326	N/A	INTRINSIC
low complexity region	353	369	N/A	INTRINSIC
low complexity region	401	426	N/A	INTRINSIC
low complexity region	461	475	N/A	INTRINSIC
low complexity region	519	534	N/A	INTRINSIC
coiled coil region	557	582	N/A	INTRINSIC
WH2	1178	1198	1.32e0	SMART
WH2	1218	1238	6.36e-3	SMART
low complexity region	1269	1289	N/A	INTRINSIC
WH2	1306	1326	3.91e-3	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adam6b	A	T	12: 113,490,995	R477S	probably damaging	Het
Aqp7	T	A	4: 41,034,929	T175S	possibly damaging	Het
Bclaf1	A	T	10: 20,322,076	R22*	probably null	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Bicc1	A	C	10: 70,958,847	V160G	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cep72	A	G	13: 74,054,881		probably null	Het
Cux1	T	G	5: 136,307,835	D941A	probably damaging	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Depdc5	T	A	5: 32,917,978	V500D	possibly damaging	Het
Dhx35	T	C	2: 158,831,711	I354T	probably damaging	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Eif4g3	C	A	4: 138,151,776	N588K	possibly damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Fam53a	T	C	5: 33,600,816	E321G	probably benign	Het
Fat4	C	A	3: 38,982,858	T3553K	possibly damaging	Het
Fer1l4	T	C	2: 156,019,313	T1978A	possibly damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Gje1	G	T	10: 14,716,740	S99R	possibly damaging	Het
Gm13083	A	G	4: 143,615,184	D61G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Gpnmb	T	C	6: 49,047,913	V293A	possibly damaging	Het
Hyi	T	A	4: 118,360,217	I62N	probably damaging	Het
Il4ra	A	G	7: 125,574,663	I267V	probably damaging	Het
Kcnd2	A	T	6: 21,216,541	Q81H	probably benign	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Lpcat4	A	G	2: 112,242,732	N208S	probably damaging	Het
Muc3	T	A	5: 137,142,298	T162S	possibly damaging	Het
Mup3	T	A	4: 62,087,174	I20F	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Pde4d	A	T	13: 109,950,940	I670L	probably damaging	Het
Phlpp1	T	A	1: 106,389,665		probably null	Het
Pigz	A	G	16: 31,941,976		probably null	Het
Prrg4	A	T	2: 104,839,362	Y137N	probably damaging	Het
Rbm28	A	T	6: 29,155,154	S217T	possibly damaging	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Slc6a18	G	T	13: 73,667,037	A384D	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Tln2	C	A	9: 67,370,733	R333L	probably damaging	Het
Tnrc6b	ACAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAG	15: 80,902,555		probably benign	Het
Ttn	G	A	2: 76,751,066	T14834I	possibly damaging	Het
Uggt1	T	C	1: 36,175,078	S177G	probably benign	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het
Zmat4	A	G	8: 24,015,127	T128A	probably benign	Het

Other mutations in Cobl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Cobl	APN	11	12375813	missense	possibly damaging	0.89
IGL00698:Cobl	APN	11	12253722	missense	probably benign	0.41
IGL00772:Cobl	APN	11	12266985	missense	probably benign	0.02
IGL00922:Cobl	APN	11	12254866	missense	probably damaging	1.00
IGL00985:Cobl	APN	11	12254843	missense	probably damaging	1.00
IGL01641:Cobl	APN	11	12309641	nonsense	probably null
IGL01722:Cobl	APN	11	12253987	missense	probably benign	0.00
IGL01734:Cobl	APN	11	12254980	splice site	probably benign
IGL01924:Cobl	APN	11	12254596	missense	probably benign	0.30
IGL02105:Cobl	APN	11	12249651	missense	probably damaging	1.00
IGL02326:Cobl	APN	11	12386712	missense	possibly damaging	0.69
IGL02342:Cobl	APN	11	12253672	missense	possibly damaging	0.64
IGL02426:Cobl	APN	11	12254351	nonsense	probably null
IGL02754:Cobl	APN	11	12254371	missense	probably damaging	1.00
IGL02754:Cobl	APN	11	12254370	missense	probably damaging	1.00
IGL02811:Cobl	APN	11	12253285	missense	possibly damaging	0.56
IGL02859:Cobl	APN	11	12369602	missense	probably damaging	1.00
IGL02999:Cobl	APN	11	12343869	missense	possibly damaging	0.71
IGL03030:Cobl	APN	11	12254241	missense	possibly damaging	0.80
IGL03191:Cobl	APN	11	12253364	missense	probably benign	0.00
PIT4418001:Cobl	UTSW	11	12256240	missense	possibly damaging	0.79
PIT4480001:Cobl	UTSW	11	12253592	missense	probably benign
PIT4495001:Cobl	UTSW	11	12254596	missense	probably benign	0.00
R0031:Cobl	UTSW	11	12254945	missense	probably benign	0.36
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0322:Cobl	UTSW	11	12267072	missense	probably damaging	1.00
R0597:Cobl	UTSW	11	12254699	missense	probably benign	0.24
R0733:Cobl	UTSW	11	12365167	missense	probably benign	0.31
R0734:Cobl	UTSW	11	12375971	missense	probably damaging	1.00
R0784:Cobl	UTSW	11	12266843	splice site	probably benign
R1065:Cobl	UTSW	11	12254327	missense	possibly damaging	0.67
R1331:Cobl	UTSW	11	12375853	missense	probably damaging	0.96
R1892:Cobl	UTSW	11	12253258	missense	probably damaging	0.99
R2847:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R2848:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R3407:Cobl	UTSW	11	12375830	missense	probably damaging	1.00
R4627:Cobl	UTSW	11	12251093	missense	probably damaging	1.00
R4662:Cobl	UTSW	11	12253672	missense	probably benign	0.08
R4677:Cobl	UTSW	11	12386665	missense	possibly damaging	0.93
R4844:Cobl	UTSW	11	12254740	missense	probably benign	0.10
R4942:Cobl	UTSW	11	12254185	missense	probably damaging	0.99
R5158:Cobl	UTSW	11	12256198	missense	possibly damaging	0.84
R5195:Cobl	UTSW	11	12253565	missense	probably benign	0.02
R5255:Cobl	UTSW	11	12375825	missense	probably damaging	1.00
R5588:Cobl	UTSW	11	12343886	nonsense	probably null
R5637:Cobl	UTSW	11	12296531	intron	probably benign
R5643:Cobl	UTSW	11	12306948	splice site	probably benign
R5749:Cobl	UTSW	11	12266965	missense	possibly damaging	0.86
R5953:Cobl	UTSW	11	12256220	missense	probably benign	0.00
R6000:Cobl	UTSW	11	12369684	missense	probably benign	0.08
R6373:Cobl	UTSW	11	12253118	missense	probably damaging	1.00
R7034:Cobl	UTSW	11	12254177	missense	probably damaging	1.00
R7071:Cobl	UTSW	11	12254795	missense	probably benign	0.00
R7077:Cobl	UTSW	11	12253441	missense	probably benign	0.04
R7078:Cobl	UTSW	11	12378271	missense	probably damaging	1.00
R7099:Cobl	UTSW	11	12296540	missense
R7153:Cobl	UTSW	11	12254128	missense	probably damaging	1.00
R7448:Cobl	UTSW	11	12256225	missense	possibly damaging	0.46
R7519:Cobl	UTSW	11	12253124	missense	probably damaging	1.00
R7767:Cobl	UTSW	11	12412117	start gained	probably benign
R7772:Cobl	UTSW	11	12254488	missense	probably benign	0.29
R7841:Cobl	UTSW	11	12253324	missense	probably damaging	1.00
R7845:Cobl	UTSW	11	12365139	missense	probably benign	0.35
R8026:Cobl	UTSW	11	12253459	missense	probably benign	0.01
R8118:Cobl	UTSW	11	12254834	missense	probably benign	0.03
R8192:Cobl	UTSW	11	12249745	missense	probably benign	0.07
R8320:Cobl	UTSW	11	12267001	missense	probably damaging	1.00
R8338:Cobl	UTSW	11	12253696	missense	probably benign	0.41
Z1176:Cobl	UTSW	11	12253433	missense	probably benign	0.02
Z1176:Cobl	UTSW	11	12369645	missense	probably damaging	1.00
Z1176:Cobl	UTSW	11	12375827	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCCACCTCTAGATAGTGTTCCTG -3'
(R):5'- TGGACCCACCAACTTTGTGGAAG -3'

Sequencing Primer
(F):5'- CTCTAGATAGTGTTCCTGACAGC -3'
(R):5'- GCTGGAAGTATCCTGCCATACC -3'

Posted On

2013-11-07