Incidental Mutation 'R0884:Olfr376'
ID81074
Institutional Source Beutler Lab
Gene Symbol Olfr376
Ensembl Gene ENSMUSG00000063881
Gene Nameolfactory receptor 376
SynonymsGA_x6K02T2P1NL-3535075-3536028, MOR135-12
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73371246-73377836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73374889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000116228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078952] [ENSMUST00000120401] [ENSMUST00000127789] [ENSMUST00000170592]
Predicted Effect probably benign
Transcript: ENSMUST00000078952
AA Change: I50F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077977
Gene: ENSMUSG00000063881
AA Change: I50F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 7.4e-8 PFAM
Pfam:7tm_1 47 296 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120401
AA Change: I47F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113236
Gene: ENSMUSG00000063881
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127789
AA Change: I47F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116228
Gene: ENSMUSG00000072709
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 231 7.3e-8 PFAM
Pfam:7tm_1 44 240 2.5e-33 PFAM
Pfam:7tm_4 142 249 4.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170592
AA Change: I47F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126073
Gene: ENSMUSG00000063881
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Olfr376
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr376 APN 11 73375007 missense probably benign 0.03
IGL01462:Olfr376 APN 11 73374752 start codon destroyed probably null 0.02
IGL01725:Olfr376 APN 11 73375156 missense probably benign 0.39
IGL02225:Olfr376 APN 11 73375078 missense probably damaging 0.98
R0006:Olfr376 UTSW 11 73375588 missense possibly damaging 0.65
R0090:Olfr376 UTSW 11 73375576 missense probably benign 0.04
R0743:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R1102:Olfr376 UTSW 11 73374874 missense probably benign 0.00
R1582:Olfr376 UTSW 11 73375264 missense probably damaging 1.00
R1765:Olfr376 UTSW 11 73375344 missense probably damaging 1.00
R1929:Olfr376 UTSW 11 73375601 missense probably damaging 1.00
R1941:Olfr376 UTSW 11 73375621 missense probably damaging 1.00
R4738:Olfr376 UTSW 11 73375350 missense possibly damaging 0.94
R4947:Olfr376 UTSW 11 73375417 nonsense probably null
R5837:Olfr376 UTSW 11 73375648 missense probably benign 0.02
R6440:Olfr376 UTSW 11 73375347 missense probably benign 0.06
R6736:Olfr376 UTSW 11 73375576 missense probably benign 0.18
R7254:Olfr376 UTSW 11 73375375 missense probably benign
R7354:Olfr376 UTSW 11 73375375 missense probably benign 0.01
R7437:Olfr376 UTSW 11 73375018 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCGATGGGAGTGCAGAGTCAATG -3'
(R):5'- GCAGATAGCCACATAGCGGTCATAG -3'

Sequencing Primer
(F):5'- CAGAGTCAATGGCACTGTTTC -3'
(R):5'- GCTTTCAAGGTCTGCAAAAAACAG -3'
Posted On2013-11-07