Incidental Mutation 'R0975:Slc5a4b'
ID81081
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76081407 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect probably benign
Transcript: ENSMUST00000120757
AA Change: V265A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: V265A

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Recql5 A C 11: 115,923,256 D240E probably damaging Het
Sec31a A C 5: 100,395,904 probably null Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGATCCTGATTCGGTGTGTCACTCTAC -3'
(R):5'- GCATACTCGGACCATTGGGGAAAG -3'

Sequencing Primer
(F):5'- CTGAAAGAGCTGAATGTGTCTC -3'
(R):5'- CTTCACTGCAATGGAGTGC -3'
Posted On2013-11-07