Incidental Mutation 'R0975:Recql5'
ID81085
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 039104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R0975 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115923256 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 240 (D240E)
Ref Sequence ENSEMBL: ENSMUSP00000137157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000131578] [ENSMUST00000134208] [ENSMUST00000140174]
Predicted Effect probably damaging
Transcript: ENSMUST00000021097
AA Change: D354E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: D354E

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131578
AA Change: D81E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752
AA Change: D81E

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134208
AA Change: D240E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137157
Gene: ENSMUSG00000020752
AA Change: D240E

DomainStartEndE-ValueType
Blast:DEXDc 25 96 4e-34 BLAST
HELICc 160 241 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134391
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156776
Meta Mutation Damage Score 0.3657 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 T C 3: 108,077,121 Y464C probably damaging Het
Arap2 A T 5: 62,730,886 probably benign Het
Arhgap5 T G 12: 52,517,144 N299K possibly damaging Het
Atl3 G A 19: 7,521,135 W210* probably null Het
Bag1 T C 4: 40,937,152 N320D probably benign Het
C530008M17Rik T C 5: 76,856,318 probably benign Het
Ccdc39 T C 3: 33,844,125 N24D probably damaging Het
Ccdc88b G A 19: 6,846,625 P1420L probably damaging Het
Cdr2 G A 7: 120,958,391 P304S probably benign Het
Col20a1 A T 2: 181,006,826 I969F possibly damaging Het
Coro1c C G 5: 113,882,121 R11P probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2c67 T G 19: 39,609,178 K459Q possibly damaging Het
Cyp2c68 T C 19: 39,703,358 T374A possibly damaging Het
Efcab6 T A 15: 83,973,331 N289I probably benign Het
Elmo1 T A 13: 20,251,137 I126N probably damaging Het
Esr2 C T 12: 76,145,308 M315I possibly damaging Het
Fbxw14 T A 9: 109,271,239 N449I probably benign Het
Frmpd1 C T 4: 45,279,000 T575I probably benign Het
Gm14403 T G 2: 177,509,424 N145K probably damaging Het
Gm5346 A G 8: 43,625,118 F690L probably benign Het
Gnl2 A G 4: 125,048,378 D392G probably damaging Het
Hmcn1 A C 1: 150,577,377 S5396A probably benign Het
Hoxd12 G T 2: 74,675,934 R230L probably damaging Het
Khsrp T A 17: 57,027,066 D154V possibly damaging Het
Klhl28 C T 12: 64,951,688 R344H possibly damaging Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Larp1b A G 3: 40,970,490 E134G probably damaging Het
Mcm9 G A 10: 53,538,646 Q113* probably null Het
Mug1 A T 6: 121,878,539 D944V probably damaging Het
Myh6 A G 14: 54,953,369 S950P probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr177 T A 16: 58,873,150 probably null Het
Olfr353 C A 2: 36,890,550 M99I possibly damaging Het
Plcb4 T C 2: 135,987,912 probably benign Het
Pomt1 T A 2: 32,253,895 probably null Het
Ppil2 T A 16: 17,107,213 T32S probably benign Het
Prpf8 T C 11: 75,508,674 probably benign Het
Rad9b C T 5: 122,334,257 probably null Het
Sec31a A C 5: 100,395,904 probably null Het
Slc5a4b A G 10: 76,081,407 V265A probably benign Het
Snx29 A T 16: 11,347,871 D7V possibly damaging Het
Stk31 C G 6: 49,423,409 D389E probably damaging Het
Tmeff2 T C 1: 50,938,205 probably benign Het
Tmem131 C T 1: 36,854,885 A146T probably damaging Het
Tmem63c T A 12: 87,075,069 probably benign Het
Tonsl T A 15: 76,638,932 D119V probably damaging Het
Trmt10a G A 3: 138,156,809 E287K probably benign Het
Vmn1r192 T A 13: 22,187,463 M196L probably damaging Het
Vmn2r9 T G 5: 108,843,303 T731P probably damaging Het
Wfdc6b G A 2: 164,613,785 M11I probably damaging Het
Zfp827 A G 8: 79,061,185 T327A probably benign Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACAAACGTCTAACCCAGCTTGC -3'
(R):5'- TGAACTCTCTCGACAGGCACACTG -3'

Sequencing Primer
(F):5'- CAGGGATTCTCCTCTAGTTACACAAG -3'
(R):5'- TGCTCCCAGAACACTTAGCTC -3'
Posted On2013-11-07